Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos

EHU140981

Sigma-Aldrich

MISSION® esiRNA

targeting human MAPK10

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAATCTTTCAGCCTGCTTCTTCCCCAGGGTTCTGTATTGCAGCTAAGCTCAAATGTATATTTAACTTCTAGTTGCTCTTGCTTTGGTCTTCTTCCAATGATGCTTACTACAGAAAGCAAATCAGACACAATTAGAGAAGCCTTTTCCATAAAGTGTAATTTTAATGGCTGCAAAACCGGCAACCTGTAACTGCCCTTTTAAATGGCATGACAAGGTGTGCAGTGGCCCCATCCAGCATGTGTGTGTCTCTATCTTGCATCTACCTGCTCCTTGGCCTAGTCAGATGGATGTAGATACAGATCCGCATGTGTCTGTATTCATACAGCACTACTTACTTAGAGATGCTACTGTCAGTGTCCTCAGGGCTCTACCAAGACATAATGCACTGGGGTACCACATG

Ensembl | human accession no.

ENSG00000109339

NCBI accession no.

NM_002753

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MAPK10(5602) , MAPK10(5602)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yang Wang et al.
Journal of medical genetics, 57(9), 634-642 (2020-02-19)
Hirschsprung disease (HSCR) is a life-threatening congenital disorder in which the enteric nervous system is completely missing from the distal gut. Recent studies have shown that miR-4516 markedly inhibits cell migration, and as one of its potential targets, MAPK10 functions
Baohua Qiao et al.
Reproductive sciences (Thousand Oaks, Calif.), 27(1), 380-388 (2020-02-13)
Ovarian cancer (OC) represents the most lethal form of gynaecologic cancers in developed countries. To develop a better therapeutic against OC, characterizing new classes of molecular regulators such as microRNAs (miRNAs) involved in OC tumorigenesis becomes immensely important. We used
Sarah Huntwork-Rodriguez et al.
The Journal of cell biology, 202(5), 747-763 (2013-08-28)
Neurons are highly polarized cells that often project axons a considerable distance. To respond to axonal damage, neurons must transmit a retrograde signal to the nucleus to enable a transcriptional stress response. Here we describe a mechanism by which this
Lihua Li et al.
Oncology reports, 37(5), 2679-2687 (2017-04-11)
miRNA-27a-3p is an important regulator of carcinogenesis and other pathological processes. However, its role in laryngeal carcinoma is still unknown. In our previous research, we found that miR-27a-3p expression was upregulated in nasopharyngeal carcinoma (NPC) using a microarray chip. In
Dan Ploug Christensen et al.
Journal of neuroinflammation, 13(1), 59-59 (2016-03-10)
Secretion of proteopathic α-synuclein (α-SNC) species from neurons is a suspected driving force in the propagation of Parkinson's disease (PD). We have previously implicated exophagy, the exocytosis of autophagosomes, as a dominant mechanism of α-SNC secretion in differentiated PC12 or
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico