Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU139841

Sigma-Aldrich

MISSION® esiRNA

targeting human PAX2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CGCAGGACCAGTTTCCATAGACTGCGGACTGGGGTCTTCCTCCAGCAGTTACTTGATGCCCCCTCCCCCGACACAGACTCTCAATCTGCCGGTGGTAAGAACCGGTTCTGAGCTGGCGTCTGAGCTGCTGCGGGGTGGAAGTGGGGGGCTGCCCACTCCACTCCTCCCATCCCCTCCCAGCCTCCTCCTCCGGCAGGAACTGAACAGAACCACAAAAAGTCTACATTTATTTAATATGATGGTCTTTGCAAAAAGGAACAAAACAACACAAAAGCCCACCAGGCTGCTGCTTTGTGGAAAGACGGTGTGTGTCGTGTGAAGGCGAAACCCGGTGTACATAACCCCTCCCCCTCCGCCCCGCCCCGCCCGGCCCCGTAGAGTCCCTGTCGCCCGCCGGCCCTGCCTGTAGATACGCCCCGCTGTCTGTGCTGTGAGAGTCGC

Ensembl | nº de acceso humano

ENSG00000075891

Nº de acceso NCBI

NM_000278

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... PAX2(5076) , PAX2(5076)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yuji Atsuta et al.
Development (Cambridge, England), 143(19), 3549-3559 (2016-09-01)
The Müllerian duct (MD) and Wolffian duct (WD) are embryonic tubular tissues giving rise to female and male reproductive tracts, respectively. In amniote embryos, both MD and WD emerge in both sexes, but subsequently degenerate in the males and females
Imlimaong Aier et al.
PloS one, 14(10), e0223554-e0223554 (2019-10-18)
Pancreatic ductal adenocarcinoma (PDAC) is notoriously difficult to treat due to its aggressive, ever resilient nature. A major drawback lies in its tumor grade; a phenomenon observed across various carcinomas, where highly differentiated and undifferentiated tumor grades, termed as low
Nan Jia et al.
Oncotarget, 7(51), 84785-84797 (2016-10-21)
This work investigated the role of paired box 2 (PAX2) in endometrial cancer and its epigenetic regulation mechanism. Endometrial cancer tissues and cell lines exhibited increased PAX2 expression compared with hyperplasia, normal endometrium and endometrial epithelial cells. Knock-down of PAX2
Huanyu Zhao et al.
Molecular carcinogenesis, 54 Suppl 1, E112-E121 (2014-08-27)
Dishevelled-3 (Dvl-3) and p120-catenin (p120ctn) have abnormal expression in non-small cell lung cancer (NSCLC), which is associated with poor prognosis. Dvl-3 upregulates p120ctn transcription in NSCLC cells, but the mechanism is unknown. Here we transiently transfected Dvl-3 cDNA to NSCLC

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico