Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos

EHU138681

Sigma-Aldrich

MISSION® esiRNA

targeting human MYOG

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCTACAGATGCCCACAACCTGCACTCCCTCACCTCCATCGTGGACAGCATCACAGTGGAAGATGTGTCTGTGGCCTTCCCAGATGAAACCATGCCCAACTGAGATTGTCTTCCAAGCCGGGCATCCTTGCGAGCCCCCCAAGCTGGCCACAGATGCCACTACTTCTGTAGCAGGGGCCTCCTAAGCCAGGCTGCCCTGATGCTAGGAAGCCAGCTCTGGGGTGCCATAGGCCAGACTATCCCCTTCCTCATCCATGTAAGGTTAACCCACCCCCCAGCAAGGGACTGGACGCCCTCATTCAGCTGCCTCCTTAGAGGAGAGGGCATCCCCTTTCCAGGGAGGTAAAGCAGGGGACCAGAGCGCCCCCTCGTGTATGCCCCAGCTCAGGGGGCAAACTCAGGAGCTTCCTTTTTATCATAACGCGGCCTC

Ensembl | human accession no.

ENSG00000122180

NCBI accession no.

NM_002479

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MYOG(4656) , MYOG(4656)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Chi Yan et al.
International journal of molecular sciences, 16(10), 25014-25030 (2015-10-23)
Fat-induced transcript 1 (FIT1/FITM1) gene is a member of the conserved gene family important for triglyceride-rich lipid droplet accumulation. FIT1 gene displays a similar muscle-specific expression across pigs, mice, and humans. Thus pigs can act as a useful model of
Adeel Malik et al.
PloS one, 10(7), e0133597-e0133597 (2015-07-23)
Muscle, a multinucleate syncytium formed by the fusion of mononuclear myoblasts, arises from quiescent progenitors (satellite cells) via activation of muscle-specific transcription factors (MyoD, Myf5, myogenin: MYOG, and MRF4). Subsequent to a decline in Pax7, induction in the expression of
Zhihui Liu et al.
Nature communications, 11(1), 911-911 (2020-02-16)
Embryonal rhabdomyosarcoma (ERMS) is a childhood cancer that expresses myogenic master regulatory factor MYOD but fails to differentiate. Here, we show that the zinc finger transcription factor CASZ1 up-regulates MYOD signature genes and induces skeletal muscle differentiation in normal myoblasts
Majid Rasool Kamli et al.
Biochemical and biophysical research communications, 450(4), 1291-1296 (2014-07-06)
Aldehyde oxidases (AOXs), which catalyze the hydroxylation of heterocycles and oxidation of a wide variety of aldehydic compounds, have been present throughout evolution from bacteria to humans. While humans have only a single functional aldehyde oxidase (AOX1) gene, rodents are
Sae-Won Lee et al.
Scientific reports, 5, 16523-16523 (2015-11-14)
Skeletal muscle regeneration occurs continuously to repair muscle damage incurred during normal activity and in chronic disease or injury. Herein, we report that A-kinase anchoring protein 6 (AKAP6) is important for skeletal myoblast differentiation and muscle regeneration. Compared with unstimulated

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico