Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU138141

Sigma-Aldrich

MISSION® esiRNA

targeting human XRCC3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTGCAGAGTGCAAGAGATGCCTCAGTCAAGTCAGCCAAAAACACGCGGGTCATCCCCAAGCCCCAGAGAGTGACAGAGCCCCGATGACACGGACACCTCGGCTGCTGTCACTTCCCTGGTTCGGGCCTCCCACAGGCTTTGAATTGAAGGCGAGTGCCTCAGAATTTGCATCCATTGTTCTGTCTTTCCTGGGAAGTTATTCATCCTGGTGGCCAGCCCACCGACAAAATGGATTTGGATCTACTGGACCTGAATCCCAGAATTATTGCTGCAATTAAGAAAGCCAAACTGAAATCGGTAAAGGAGGTTTTACACTTTTCTGGACCAGACTTGAAGAGACTGACCAACCTCTCCAGCCCCGAGGTCTGGCACTTGCTGAGAACGGCCTCCTTACACTTGCGGGGAAGCAGCATCCTTACAGCACTGCAGCTG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Wynand P Roos et al.
Cancer letters, 424, 119-126 (2018-03-27)
Glioblastoma is the most frequent and aggressive form of high-grade malignant glioma. Due to the dismal prognosis faced by patients suffering from this disease, there is a need for identifying new targets that might improve therapy. The aim of this
Ramon Lopez Perez et al.
Radiotherapy and oncology : journal of the European Society for Therapeutic Radiology and Oncology, 133, 77-86 (2019-04-03)
Carbon ion radiotherapy is a promising therapeutic option for glioblastoma patients due to its high physical dose conformity and greater biological effectiveness than photons. However, the biological effects of carbon ion radiation are still incompletely understood. Here, we systematically compared
Jo-Fan Chang et al.
Toxicological sciences : an official journal of the Society of Toxicology, 139(2), 396-406 (2014-03-29)
The nucleus is a key organelle in mammary cells, which is responsible for several cellular functions including cell proliferation, gene expression, and cell survival. In addition, the nucleus is the primary targets of doxorubicin treatment. In the current study, low-abundance
Marco Agostini et al.
Cancer biology & therapy, 16(8), 1160-1171 (2015-05-30)
Preoperative chemoradiotherapy is widely used to improve local control of disease, sphincter preservation and to improve survival in patients with locally advanced rectal cancer. Patients enrolled in the present study underwent preoperative chemoradiotherapy, followed by surgical excision. Response to chemoradiotherapy

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico