Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU134901

Sigma-Aldrich

MISSION® esiRNA

targeting human PDLIM7

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
$220.00
50 μG
$391.00

$220.00

Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
$220.00
50 μG
$391.00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

$220.00

Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GAGCCGCACCTCCATTGTGCAGGCAGCTGCCGGAGGGGTGCCAGGAGGGGGCAGCAACAACGGCAAGACTCCCGTGTGTCACCAGTGCCACAAGGTCATCCGGGGCCGCTACCTGGTGGCGCTGGGCCACGCGTACCACCCGGAGGAGTTTGTGTGTAGCCAGTGTGGGAAGGTCCTGGAAGAGGGTGGCTTCTTTGAGGAGAAGGGCGCCATCTTCTGCCCACCATGCTATGACGTGCGCTATGCACCCAGCTGTGCCAAGTGCAAGAAGAAGATTACAGGCGAGATCATGCACGCCCTGAAGATGACCTGGCACGTGCACTGCTTTACCTGTGCTGCCTGCAAGACGCCCATCCGGAACAGGGCCTTCTACATGGAGGAGGGCGTGCCCTATTGCGAGCGAGACTATGAGAAGATGTTTGGCACGA

Ensembl | nº de acceso humano

ENSG00000196923

Nº de acceso NCBI

NM_005451

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... PDLIM7(9260) , PDLIM7(9260)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Toshihiro Nagato et al.
Laboratory investigation; a journal of technical methods and pathology, 99(5), 612-624 (2019-01-22)
Nasal natural killer/T-cell lymphoma (NNKTL) is closely associated with Epstein-Barr virus (EBV) and is characterized by poor prognosis, resulting from rapid progression of lesions in the affected organs. Recent data have shown that NNKTL is associated with the aberrant expression
Seung-Woo Hong et al.
Current eye research, 45(9), 1136-1143 (2020-01-18)
Epstein-Barr virus is a γ-herpes virus that infects primary B cells and can transform infected cells into immortalized lymphoblastoid cell lines (LCL). The role of EBV in malignancies such as Burkitt's lymphoma and nasopharyngeal carcinoma is well understood, however, its

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico