Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU134461

Sigma-Aldrich

MISSION® esiRNA

targeting human TREM1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGATCTACCAGCCTCCCAAGGAGCCTCACATGCTGTTCGATCGCATCCGCTTGGTGGTGACCAAGGGTTTTTCAGGGACCCCTGGCTCCAATGAGAATTCTACCCAGAATGTGTATAAGATTCCTCCTACCACCACTAAGGCCTTGTGCCCACTCTATACCAGCCCCAGAACTGTGACCCAAGCTCCACCCAAGTCAACTGCCGATGTCTCCACTCCTGACTCTGAAATCAACCTTACAAATGTGACAGATATCATCAGGGTTCCGGTGTTCAACATTGTCATTCTCCTGGCTGGTGGATTCCTGAGTAAGAGCCTGGTCTTCTCTGTCCTGTTTGCTGTCACGCTGAGGTCATTTGTACCCTAGGCCCACGAACCCACGAGAATGTCCTCTGACTTCCAGCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xiaoliang Zhang et al.
PloS one, 14(9), e0221991-e0221991 (2019-09-12)
This study aimed to examine the macrophage phenotype and its relationship to renal function and histological changes in human DN and the effect of TREM-1 on high-glucose-induced macrophage activation. We observed that in renal tissue biopsies, the expression of CD68
Danping Fan et al.
International journal of molecular sciences, 17(4), 498-498 (2016-04-07)
Triptolide (TP), an active component isolated from Tripterygiumwilfordii Hook F, has therapeutic potential against rheumatoid arthritis (RA). However, the underlying molecular mechanism has not been fully elucidated. The aim of this study is to investigate the mechanisms of TP acting
Jianfei Tang et al.
Biochemical and biophysical research communications, 482(4), 1240-1245 (2016-12-10)
Triggering receptor expressed on myeloid cells 1 (TREM-1) is a recently discovered molecule that modulates inflammatory responses. This study aimed to investigate the specific function of TREM-1 in chondrocytes and its association with the pathophysiology of osteoarthritis (OA). We observed
Mansoor Ali Syed et al.
American journal of respiratory cell and molecular biology, 60(3), 308-322 (2018-10-04)
Hyperoxia-induced injury to the developing lung, impaired alveolarization, and dysregulated vascularization are critical factors in the pathogenesis of bronchopulmonary dysplasia (BPD); however, mechanisms for hyperoxia-induced development of BPD are not fully known. In this study, we show that TREM-1 (triggering

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico