Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU131401

Sigma-Aldrich

MISSION® esiRNA

targeting human IGFBP1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTGCCAAACTGCAACAAGAATGGATTTTATCACAGCAGACAGTGTGAGACATCCATGGATGGAGAGGCGGGACTCTGCTGGTGCGTCTACCCTTGGAATGGGAAGAGGATCCCTGGGTCTCCAGAGATCAGGGGAGACCCCAACTGCCAGATATATTTTAATGTACAAAACTGAAACCAGATGAAATAATGTTCTGTCACGTGAAATATTTAAGTATATAGTATATTTATACTCTAGAACATGCACATTTATATATATATGTATATGTATATATATATAGTAACTACTTTTTATACTCCATACATAACTTGATATAGAAAGCTGTTTATTTATTCACTGTAAGTTTATTTTTTCTACACAGTAAAAACTTGTACTATGTTAATAACTTGTCCTATGTCAATTTGTATATCATGAAACACTTCTCATCATATTGTATGTAAGTAATTGCATTTCTGCTCTTCCAAAGCTCC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Fang Zheng et al.
Experimental & molecular medicine, 50(9), 121-121 (2018-09-14)
β-Elemene, an active component of natural plants, has been shown to exhibit anticancer properties. However, the detailed mechanism underlying these effects has yet to be determined. In this study, we show that β-elemene inhibits the growth of lung cancer cells.
Hideno Tochigi et al.
Scientific reports, 7, 40001-40001 (2017-01-05)
Endometrial decidualization represents an essential step for the successful implantation of the embryo; however, the molecular mechanism behind this differentiation process remains unclear. This study aimed to identify novel microRNAs (miRNAs) involved in the regulation of decidual gene expression in
Ali Vaziri-Gohar et al.
Molecular and cellular endocrinology, 422, 160-171 (2015-12-23)
Tamoxifen, a selective estrogen receptor modulator, is a commonly prescribed adjuvant therapy for estrogen receptor-α (ERα)-positive breast cancer patients. To determine if extracellular factors contribute to the modulation of IGF-1 signaling after tamoxifen treatment, MCF-7 cells were treated with IGF-1 in

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico