Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU130651

Sigma-Aldrich

MISSION® esiRNA

targeting human NDUFAF1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GTTGTGAGCCGTCAGTGAAACACTTAGAGCAGTTTCTGGCACATGGTAGAATTGGGCTATTTGCTGAAGCTTCTTGGTGGCCCTTGCTAGCCCAGGAAGAAACTTACATTTTGATTTTTTTGTACCATGGCTTTGGTTCACAAATTGCTGCGTGGTACTTATTTTCTCAGAAAATTCTCTAAGCCAACTTCTGCCTTGTATCCATTTTTGGGTATTCGCTTTGCAGAGTATTCCAGTAGTCTTCAGAAACCAGTGGCTTCTCCTGGCAAAGCCTCCTCACAGAGGAAGACTGAAGGGGATTTGCAAGGAGATCACCAGAAAGAAGTTGCTTTGGATATAACTTCTTCTGAGGAGAAGCCTGATGTTAGTTTCGATAAAGCAATTAGAGATGAAGCAATATACCATTTTAGGCTTTTGAAGGATGAAATTGTGGATCATTGGAGAGGACCGGAAGGCCACCCTCTGCATGAGGTCTTGCTGGAACAAGC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Kelly Quesnelle et al.
Nitric oxide : biology and chemistry, 104-105, 36-43 (2020-09-07)
It is well established that myoglobin supports mitochondrial respiration through the storage and transport of oxygen as well as through the scavenging of nitric oxide. However, during ischemia/reperfusion (I/R), myoglobin and mitochondria both propagate myocardial injury through the production of
Satomi Miwa et al.
Nature communications, 5, 3837-3837 (2014-05-13)
Mitochondrial function is an important determinant of the ageing process; however, the mitochondrial properties that enable longevity are not well understood. Here we show that optimal assembly of mitochondrial complex I predicts longevity in mice. Using an unbiased high-coverage high-confidence

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico