Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU126681

Sigma-Aldrich

MISSION® esiRNA

targeting human APRT

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGGCACCTGTACCCTTCTTCTCTCTCCTGCAGTATGAGTGACCACAGGGCCTCCCAGCCCAACATCTCCAGCTGGATCCCAGGGAAATATCAGCCTTGGGCAACTGCAGTGACCAGGGGCACCGGCTGCCCACAGGGAACACATTCCTTTGCTGGGGTTCAGCGCCTCTCCTGGGGCTGGAAGTGCCAAAGCCTGGGGCAAAGCTGTGTTTCAGCCACACTGAACC

Ensembl | nº de acceso humano

ENSG00000198931

Nº de acceso NCBI

NM_000485

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... APRT(353) , APRT(353)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jon Pey et al.
Scientific reports, 7(1), 14358-14358 (2017-11-01)
Constraint-based modeling for genome-scale metabolic networks has emerged in the last years as a promising approach to elucidate drug targets in cancer. Beyond the canonical biosynthetic routes to produce biomass, it is of key importance to focus on metabolic routes
Yi-Fang Cheng et al.
PloS one, 10(11), e0142283-e0142283 (2015-11-07)
The AMP-activated protein kinase (AMPK) signaling system plays a key role in cellular stress by repressing the inflammatory responses induced by the nuclear factor-kappa B (NF-κB) system. Previous studies suggest that the anti-inflammatory role of AMPK involves activation by adenine

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico