Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU126621

Sigma-Aldrich

MISSION® esiRNA

targeting human DLL1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCCGTTGCACTATGGACAGTTGCTCTTAAGAGAATATATATTTAAATGGGTGAACTGAATTACGCATAAGAAGCATGCACTGCCTGAGTGTATATTTTGGATTCTTATGAGCCAGTCTTTTCTTGAATTAGAAACACAAACACTGCCTTTATTGTCCTTTTTGATACGAAGATGTGCTTTTTCTAGATGGAAAAGATGTGTGTTATTTTTTGGATTTGTAAAAATATTTTTCATGATATCTGTAAAGCTTGAGTATTTTGTGATGTTCGTTTTTTATAATTTAAATTTTGGTAAATATGTACAAAGGCACTTCGGGTCT

Ensembl | nº de acceso humano

ENSG00000198719

Nº de acceso NCBI

NM_005618

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... DLL1(28514) , DLL1(28514)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Kashyap Krishnasamy et al.
Nature communications, 8(1), 952-952 (2017-10-19)
Ischemia causes an inflammatory response that is intended to restore perfusion and homeostasis yet often aggravates damage. Here we show, using conditional genetic deletion strategies together with adoptive cell transfer experiments in a mouse model of hind limb ischemia, that
Mayank Verma et al.
Cell stem cell, 23(4), 530-543 (2018-10-06)
Skeletal muscle is a complex tissue containing tissue resident muscle stem cells (satellite cells) (MuSCs) important for postnatal muscle growth and regeneration. Quantitative analysis of the biological function of MuSCs and the molecular pathways responsible for a potential juxtavascular niche for

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico