EHU125211
MISSION® esiRNA
targeting human SCARB1
Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
About This Item
Código UNSPSC:
41105324
NACRES:
NA.51
Productos recomendados
descripción
Powered by Eupheria Biotech
Línea del producto
MISSION®
Formulario
lyophilized powder
secuencia objetivo ADNc esiRNA
CTGTGGGTGAGATCATGTGGGGCTACAAGGACCCCCTTGTGAATCTCATCAACAAGTACTTTCCAGGCATGTTCCCCTTCAAGGACAAGTTCGGATTATTTGCTGAGCTCAACAACTCCGACTCTGGGCTCTTCACGGTGTTCACGGGGGTCCAGAACATCAGCAGGATCCACCTCGTGGACAAGTGGAACGGGCTGAGCAAGGTTGACTTCTGGC
Ensembl | nº de acceso humano
Nº de acceso NCBI
Condiciones de envío
ambient
temp. de almacenamiento
−20°C
Información sobre el gen
human ... SCARB1(949) , SCARB1(949)
Categorías relacionadas
Descripción general
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Información legal
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Código de clase de almacenamiento
10 - Combustible liquids
Punto de inflamabilidad (°F)
Not applicable
Punto de inflamabilidad (°C)
Not applicable
Elija entre una de las versiones más recientes:
¿Ya tiene este producto?
Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.
Ilaria Crivellari et al.
Free radical biology & medicine, 102, 47-56 (2016-11-21)
For its critical location, the skin represents the major interface between the body and the environment, therefore is one of the major biological barriers against the outdoor environmental stressors. Among the several oxidative environmental stressors, cigarette smoke (CS) has been
Vasily Sukhorukov et al.
Biochimica et biophysica acta. Molecular and cell biology of lipids, 1864(5), 643-653 (2019-01-15)
Human plasma lipoproteins are known to contain various glycan structures whose composition and functional importance are starting to be recognized. We assessed N-glycosylation of human plasma HDL and LDL and the role of their glycomes in cellular cholesterol metabolism. N-glycomic
Rene Raphemot et al.
Cell chemical biology, 26(9), 1253-1262 (2019-07-02)
Plasmodium parasites undergo an obligatory and asymptomatic developmental stage within the liver before infecting red blood cells to cause malaria. The hijacked host pathways critical to parasite infection during this hepatic phase remain poorly understood. Here, we implemented a forward
Zhou-Yi Wu et al.
European journal of pharmacology, 853, 111-120 (2019-03-25)
Farnesoid X receptor (FXR) agonists play important regulatory roles in bile acid, lipid and glucose metabolism in vitro and in vivo. Thus, FXR agonists exhibit potential therapeutic effects on metabolism-related diseases that are associated with extrahepatic manifestations induced by hepatitis
Alain Lescoat et al.
Frontiers in immunology, 11, 219-219 (2020-03-07)
Inhalation of crystalline silica (SiO2) is a risk factor of systemic autoimmune diseases such as systemic sclerosis (SSc) and fibrotic pulmonary disorders such as silicosis. A defect of apoptotic cell clearance (i.e., efferocytosis, a key process in the resolution of
Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.
Póngase en contacto con el Servicio técnico