Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EHU124091

Sigma-Aldrich

MISSION® esiRNA

targeting human FGF5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CATTCTTTCCACTGAATGCATAATGTTTAAATAGCATAAAATGAAATGCTACAAAAATTGAACTAATTTATACTTTAAAGTATTTCTGGGTTAAATGAAACAATGAAATTTTTTAGTATGTTCAACTCTCATCCAAATGGCATATGACCCTGTTTACACAGCCTAAAGCTAAAAATATTACTCTAGTTTATTCTAATCTATTGTTAAGTATTGTGCACTGTATACCAAGTTCTTAGGGCACATGAAAAATTTTAGCTGCCAAACAGGAACTAGTAAACATATGTTCCTAATAAGTGAAGGGAAAGATAATAATGATGGTCAACAATAAGCCACGTCAATGCATAAGTTGTATAGGCTAAATGTTGCTTGTAGGCTACATTAAACTCAAATGTAATAGTTTATCTTATACTCCTGGTTTGATTTGATTAGCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Categorías relacionadas

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Sara Ghassemi et al.
Oncotarget, 8(50), 87750-87762 (2017-11-21)
Although FGF5 mRNA was previously found expressed in some melanoma cell lines in contrast to normal human melanocytes, neither its contribution to melanoma growth nor its expression in melanoma tissue has been investigated. Here we demonstrate that ectopic overexpression of
Zheng Zhu et al.
Oncology reports, 45(2), 501-512 (2021-01-09)
Hsa_circ_0016760 expression has been reported to be increased in non‑small cell lung cancer (NSCLC). The present study was designed to explore the role and mechanism of hsa_circ_0016760 in regulating NSCLC progression. In total, 60NSCLC patients were followed‑up for 60 months after surgery.
Yanjuan Zhou et al.
Journal of cellular biochemistry (2018-12-07)
The morbidity and mortality rates of nonsmall-cell lung cancer (NSCLC) have increased in recent years. We aimed to explore the biological role of fibroblast growth factor 5 (FGF5) in NSCLC. We first established that the expression of FGF5 was increased

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico