Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EHU123971

Sigma-Aldrich

MISSION® esiRNA

targeting human MOK

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGCACCCCTACTTCCAAGAACAGAGGAAAACAGAGAAGCGGGCTCTGGGCAGCCACAGAAAAGCTGGCTTTCCGGAGCACCCTGTGGCACCGGAACCACTCAGTAACAGCTGCCAGATTTCCAAGGAGGGCAGAAAGCAGAAACAGTCCCTAAAGCAAGAGGAGGACCGTCCCAAGAGACGAGGACCGGCCTATGTCATGGAACTGCCCAAACTAAAGCTTTCGGGAGTGGTCAGACTGTCGTCTTACTCCAGCCCCACGCTGCAGTCCGTGCTTGGATCTGGAACAAATGGAAGAGTGCCGGTGCTGAGACCCTTGAAGTGCATCCCTGCGAGCAAGAAGACAGATCCGCAGAAGGACCTTAAGCCTGCCCCGCAGCAGTGTCGCCTGCCCACCATAGTGCGGAAAGGCGGAAGATAACTGAGCAGCACCG

Ensembl | human accession no.

ENSG00000080823

NCBI accession no.

NM_014226

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MOK(5891) , RAGE(5891)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Wenbin Ye et al.
Apoptosis : an international journal on programmed cell death, 22(1), 86-97 (2016-11-20)
This study aimed to investigate the effect of AOPPs on apoptosis in human chondrocytes. Chondrocytes were treated with AOPPs. Cell death, nicotinamide adenine dinucleotide phosphate (NADPH) oxidase activity, reactive oxygen species (ROS) generation, and the expression of apoptotic proteins were
Bikesh K Nirala et al.
Diabetes & vascular disease research, 12(4), 290-297 (2015-05-13)
Pro-inflammatory conditions induced by products of protein glycation in diabetes substantially enhance the risk of endothelial dysfunction and related vascular complications. Endothelial cell specific molecule-1 (ESM-1) or endocan has been demonstrated as a potential biomarker in cancer and sepsis. Its
Yan Xia Yu et al.
American journal of translational research, 9(6), 2760-2774 (2017-07-04)
Non-small cell lung cancer (NSCLC) constitutes the main cases of lung cancer and is the world's most common and lethal cancer owing to regional invasion or distant metastasis. Growing morbidity and lethality demonstrates that valid molecular target in management of
Yosuke Kanno et al.
Arthritis research & therapy, 22(1), 76-76 (2020-04-11)
Fibrotic diseases are characterized by tissue overgrowth, hardening, and/or scarring because of the excessive production, deposition, and contraction of the extracellular matrix (ECM). However, the detailed mechanisms underlying these disorders remain unclear. It was recently reported that α2-antiplasmin (α2AP) is
Fang Yang et al.
Brain research bulletin, 163, 49-56 (2020-07-06)
A pivotal role of glutamatergic neurotransmission in the pathophysiology of major depressive disorder (MDD) has been supported in preclinical and clinical studies. Glutamate transporters are responsible for rapid uptake of glutamate to maintain glutamate homeostasis. Down-regulation of glutamate transporters has
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico