Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU123581

Sigma-Aldrich

MISSION® esiRNA

targeting human THPO

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCTCAGACACTGCCGACATCAGCATTGTCTCGTGTACAGCTCCCTTCCCTGCAGGGCGCCCCTGGGAGACAACTGGACAAGATTTCCTACTTTCTCCTGAAACCCAAAGCCCTGGTAAAAGGGATACACAGGACTGAAAAGGGAATCATTTTTCACTGTACATTATAAACCTTCAGAAGCTATTTTTTTAAGCTATCAGCAATACTCATCAGAGCAGCTAGCTCTTTGGTCTATTTTCTGCAGAAATTTGCAACTCACTGATTCTCTACATGCTCTTTTTCTGTGATAACTCTGCAAAGGCCTGGGCTGGCCTGGCAGTTGAACAGAGGGAGAGACTAACCTTGAGTCAGAAAACAGAGAAAGGGTAATTTCCTTTGCTTCAAATTCAAGGCCTTCCAACGCCCCCATCCCCTTTACTATCATTCTCAGTGGGACTCTGATCCC

Ensembl | nº de acceso humano

ENSG00000090534

Nº de acceso NCBI

NM_000460

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... THPO(7066) , THPO(7066)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ting Zou et al.
Cancer biomarkers : section A of Disease markers, 25(2), 133-139 (2018-11-20)
Long noncoding RNAs (LncRNAs) are involved in the occurrence and progression of human tumors including ovarian cancer (OC). Long noncoding RNA HOTTIP has been found to be involved in several human tumors development. However, the role of HOTTIP in OC
Bo Li et al.
Free radical research, 52(4), 390-401 (2018-02-06)
Substantial evidence indicates that the alteration of the cellular redox status is a critical factor involved in cell growth and death and results in tumourigenesis. Cancer cells have an efficient antioxidant system to counteract the increased generation of ROS. However
Hideo Otsuki et al.
The Prostate, 77(2), 222-233 (2016-10-04)
Leucine stimulates cancer cell proliferation through the mTOR pathway, therefore, inhibiting leucine transporters may be a novel therapeutic target for cancer. L-type amino acid transporter (LAT) 1, a Na LNCaP and DU145 and PC-3 cell lines were used as a
Bo-Wen Dai et al.
Journal of Cancer, 10(19), 4540-4551 (2019-09-19)
As a master regulator of embryonic morphogenesis, homeodomain-containing gene 10 (HOXC10) has been found to promote progression of human cancers and indicate poor survival outcome. Therefore, we concentrate on elucidating the role of HOXC10 in progression of oral squamous cell
Jie Zhang et al.
Disease markers, 2019, 8964015-8964015 (2019-11-30)
Cyclin-dependent kinase regulatory subunit 2 (CKS2) is a member of the cell cycle-dependent protein kinase subunit family, which is implicated as an oncogene in various malignancies. However, the clinical significance, oncogenic functions, and related mechanisms of CKS2 in hepatocellular carcinoma
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico