Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos

EHU122711

Sigma-Aldrich

MISSION® esiRNA

targeting human ARHGEF12

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGTGCAGCTGTTTCCAGAGCATTGAATTACTAAAATCTCGCCCGGCTCATTTGGCTGTTTTCTTACACCATGTAGTTTCACAATTTGACCCTGCGACTTTGCTCTGTTATCTCTATTCAGACCTGTATAAACATACCAATTCCAAAGAAACTCGTCGCATCTTCCTTGAGTTTCATCAGTTCTTTCTAGATCGATCAGCACACCTGAAAGTTTCTGTTCCTGATGAAATGTCTGCAGATCTAGAAAAGAGAAGACCTGAGCTCATTCCTGAGGATCTGCATCGCCACTATATCCAAACTATGCAAGAAAGAGTCCATCCAGAAGTTCAAAGGCACTTAGAAGATTTTCGGCAGAAACGTAGTATGGGACTGACCTTGGCTGAAAGCGAGCTGACTAAACTTGATGCAGAGCGAGACA

Ensembl | human accession no.

ENSG00000196914

NCBI accession no.

NM_015313

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ARHGEF12(23365) , ARHGEF12(23365)

Categorías relacionadas

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Wei-Chiao Chiu et al.
International journal of nanomedicine, 7, 5929-5939 (2012-12-13)
Studies to explore angiotensin II (Ang II) and its downstream signaling pathways via Rho guanine nucleotide exchange factors (RhoGEFs) and RhoA signaling are crucial to understanding the mechanisms of smooth muscle contraction leading to hypertension. This study aimed to investigate
Katsuhiko Hata et al.
The Journal of cell biology, 184(5), 737-750 (2009-03-11)
Neuronal axons are guided by attractive and repulsive cues in their local environment. Because the repulsive guidance molecule A (RGMa) was originally identified as an axon repellent in the visual system, diverse functions in the developing and adult central nervous
Anil Prasad et al.
Scientific reports, 7, 40648-40648 (2017-01-18)
DC-SIGN is a dendritic cell surface structure which participates in binding and transmission of HIV-1. Here, for the first time we demonstrate that cocaine induces over expression of DC-SIGN and significantly enhances virus transfer from DCs to T-cells by increasing
Michelle Rengarajan et al.
Molecular biology of the cell, 31(19), 2097-2106 (2020-06-26)
Interactions between host cells and individual pathogenic bacteria determine the clinical severity of disease during systemic infection in humans. Vascular endothelial cells, which line the lumen of blood vessels, represent a critical barrier for a bacterium in the bloodstream. These
Jing Cai et al.
Genes & development, 32(11-12), 781-793 (2018-06-13)
Autosomal dominant polycystic kidney disease (ADPKD) is an inherited disorder caused by mutations in PKD1 or PKD2 and affects one in 500-1000 humans. Limited treatment is currently available for ADPKD. Here we identify the Hippo signaling effector YAP and its

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico