Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU122081

Sigma-Aldrich

MISSION® esiRNA

targeting human ATG2A

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGAGAAGGGAGAGGAACTGGAGCTGTCAGTGGAGAGTCCCTGTGAGCTGCGGGAACCTGAGCCCTCGCCCTTCTCCTCTAAGAGGACCATGTATGAGACAGAGGAGATGGTGATCCCTGGAGACCCTGAGGAGATGAGGACGTTCCAGAGCCGGACCCTGGCACTGTCCCGCTGCAGCCTGGAAGTGATCCTGCCCAGTGTCCACATCTTTCTGCCCAGCAAGGAGGTCTACGAGAGCATCTACAACAGGATCAACAACGACCTGCTCATGTGGGAGCCTGCAGATCTGCTTCCCACCCCCGACCCCGCCGCCCAGCCCTCGGGCTTCCCCGGCCCCTCAGGCTTCTGGCACGACAGCTTTAAGATGTGCAAGTCAGCCTTCAAGCTGGCCAACTGCTTTGATCTCACCCCAGACTCGGACTCGGATGACGAGGATGCCCACTTCTTCTCA

Ensembl | nº de acceso humano

ENSG00000110046

Nº de acceso NCBI

NM_015104

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... ATG2A(23130) , ATG2A(23130)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QCS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ying Li et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(12), 16716-16735 (2020-10-31)
Mounting evidence from epidemiological and clinical studies has revealed marked correlations between the air pollutant fine particulate matter (FPM) and respiratory diseases. FPM reaches distal airways and deposits in alveolar regions where it can act directly on alveolar macrophages. However
Simon G Pfisterer et al.
Journal of lipid research, 55(7), 1267-1278 (2014-04-30)
Autophagy is a lysosomal bulk degradation pathway for cytoplasmic cargo, such as long-lived proteins, lipids, and organelles. Induced upon nutrient starvation, autophagic degradation is accomplished by the concerted actions of autophagy-related (ATG) proteins. Here we demonstrate that two ATGs, human

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico