Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU115601

Sigma-Aldrich

MISSION® esiRNA

targeting human KRT19

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGCAACGAGAAGCTAACCATGCAGAACCTCAACGACCGCCTGGCCTCCTACCTGGACAAGGTGCGCGCCCTGGAGGCGGCCAACGGCGAGCTAGAGGTGAAGATCCGCGACTGGTACCAGAAGCAGGGGCCTGGGCCCTCCCGCGACTACAGCCACTACTACACGACCATCCAGGACCTGCGGGACAAGATTCTTGGTGCCACCATTGAGAACTCCAGGATTGTCCTGCAGATCGACAATGCCCGTCTGGCTGCAGATGACTTCCGAACCAAGTTTGAGACGGAACAGGCTCTGCGCATGAGCGTGGAGGCCGACATCAACGGCCTGCGCAGGGTGCTGGATGAGCTGACCCTGGCCAGGACCGACCTGGAGATGCAGATCGAAGGCCTGAAGGAAGAGCT

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Masato Takano et al.
BMC cancer, 16(1), 903-903 (2016-11-20)
Keratin (K) 19-positive hepatocellular carcinoma (HCC) is well known to have a higher malignant potential than K19-negative HCC: However, the molecular mechanisms involved in K19-mediated progression of HCC remain unclear. We attempted to clarify whether K19 directly affects cell survival
Takayuki Kawai et al.
Cancer medicine, 6(11), 2531-2540 (2017-10-02)
The current lack of an easily measurable surrogate marker of cancer stem cells (CSCs) prevents the clinical application of CSCs for hepatocellular carcinoma (HCC). We previously reported that keratin 19 (K19) is a novel HCC-CSC marker associated with transforming growth
Tomoaki Ohtsuka et al.
Scientific reports, 6, 39557-39557 (2016-12-23)
HER2 is a receptor tyrosine kinase and its upregulation via activating mutations or amplification has been identified in some malignant tumors, including lung cancers. Because HER2 can be a therapeutic target in HER2-driven malignancies, it is important to understand the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico