Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EHU114821

Sigma-Aldrich

MISSION® esiRNA

targeting human TERF1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCTTGATGCACAGTTTGAAAATGATGAACGAATTACACCCTTGGAATCAGCCCTGATGATTTGGGGTTCAATTGAAAAGGAACATGACAAACTTCATGAAGAAATACAGAATTTAATTAAAATTCAGGCTATAGCTGTTTGTATGGAAAATGGCAACTTTAAAGAAGCAGAAGAAGTCTTTGAAAGAATATTTGGTGATCCAAATTCTCATATGCCTTTCAAAAGCAAATTGCTTATGATAATCTCTCAGAAAGATACATTTCATTCCTTTTTTCAACACTTCAGCTACAACCACATGATGGAGAAAATTAAGAGTTATGTGAATTATGTGCTAAGTGAAAAATCATCAACCTTTCTAATGAAGGCAGCGGCAAAAGTAGTAGAAAGCAAAAGGACAAGAACAA

Ensembl | human accession no.

ENSG00000147601

NCBI accession no.

NM_003218

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... TERF1(7013) , TERF1(7013)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Surya Shin Ichi Sutanto et al.
Journal of cell communication and signaling, 13(4), 523-530 (2019-06-17)
People with diabetes mellitus have shorter telomeres compared with non-diabetic subjects. The aim of this study was to investigate an in-vitro model of telomere shortening under diabetes metabolic conditions. The mechanisms of the accelerated telomere length attrition and the potential
Rosa Maria Porreca et al.
eLife, 9 (2020-01-15)
Telomeres are a significant challenge to DNA replication and are prone to replication stress and telomere fragility. The shelterin component TRF1 facilitates telomere replication but the molecular mechanism remains uncertain. By interrogating the proteomic composition of telomeres, we show that
Luxi Sun et al.
Nucleic acids research, 45(7), 3844-3859 (2017-02-06)
Werner syndrome (WS) is a progeroid-like syndrome caused by WRN gene mutations. WS cells exhibit shorter telomere length compared to normal cells, but it is not fully understood how WRN deficiency leads directly to telomere dysfunction. By generating localized telomere-specific
Lu Yang et al.
Nucleic acids research, 45(7), 3906-3921 (2017-02-06)
Oxidative DNA damage triggers telomere erosion and cellular senescence. However, how repair is initiated at telomeres is largely unknown. Here, we found unlike PARP1-mediated Poly-ADP-Ribosylation (PARylation) at genomic damage sites, PARylation at telomeres is mainly dependent on tankyrase1 (TNKS1). TNKS1

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico