Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU106231

Sigma-Aldrich

MISSION® esiRNA

targeting human PGD

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AAGTTCCAAGACACCGATGGCAAACACCTGCTGCCAAAGATCAGGGACAGCGCGGGGCAGAAGGGCACAGGGAAGTGGACCGCCATCTCCGCCCTGGAATACGGCGTACCCGTCACCCTCATTGGAGAAGCTGTCTTTGCTCGGTGCTTATCATCTCTGAAGGATGAGAGAATTCAAGCTAGCAAAAAGCTGAAGGGTCCCCAGAAGTTCCAGTTTGATGGTGATAAGAAATCATTCCTGGAGGACATTCGGAAGGCACTCTACGCTTCCAAGATCATCTCTTACGCTCAAGGCTTTATGCTGCTAAGGCAGGCAGCCACCGAGTTTGGCTGGACTCTCAATTATGGTGGCATCGCCCTGATGTGGAGAGGGGGCTGCATCATTAGAAGTGTATTCCTAGGAAAGATAAAGGATGCATTTGATCGAAACC

Ensembl | nº de acceso humano

ENSG00000142657

Nº de acceso NCBI

NM_002631

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... PGD(5226) , PGD(5226)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
BBV
DOR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jun Cao et al.
The American journal of the medical sciences, 360(3), 279-286 (2020-08-25)
The essential role of 6-phosphogluconate dehydrogenase (6PGD), the enzyme catalyzing the oxidative pentose phosphate pathway, in tumor growth and metabolism has garnered attention in recent years. In this work, we are the first to demonstrate that aberrant activation of 6PGD
Xiaoyu Yang et al.
Clinical & translational oncology : official publication of the Federation of Spanish Oncology Societies and of the National Cancer Institute of Mexico, 20(9), 1145-1152 (2018-01-18)
6-phosphogluconate dehydrogenase (6PGD), a key enzyme of the oxidative pentose phosphate pathway, is involved in tumor growth and metabolism. Although high 6PGD activity has been shown to be associated with poor prognosis, its role and therapeutic value in breast cancer
Wujian Zheng et al.
Frontiers in pharmacology, 8, 421-421 (2017-07-18)
Cisplatin (DDP) is currently one of the most commonly used chemotherapeutic drugs for treating ovarian and lung cancer. However, resistance to cisplatin is common and it often leads to therapy failure. In addition, the precise mechanism of cisplatin resistance is

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico