Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU097001

Sigma-Aldrich

MISSION® esiRNA

targeting human DMBT1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
$220.00
50 μG
$391.00

$220.00

Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
$220.00
50 μG
$391.00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

$220.00

Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCCCTTACTACGTGGACCTGAACCAGGACTTGTACGTTCAGGCTGAAATCCTCCATTCTGATGCTGTACTGACCTTGTTTGTGGACACCTGCGTGGCATCACCATACTCCAATGACTTCACGTCTTTGACTTATGATCTAATCCGGAGTGGATGCGTGAGGGATGACACCTACGGACCCTACTCCTCGCCATCTCTTCGCATTGCCCGCTTCCGGTTCAGGGCCTTCCACTTCCTGAACCGCTTCCCCTCCGTGTACCTGCGTTGTAAAATGGTGGTGTGCAGAGCGTATGACCCCTCTTCCCGCTGCTACCGAGGCTGTGTGTTGAG

Ensembl | nº de acceso humano

ENSG00000187908

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... DMBT1(1755) , DMBT1(1755)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QCS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Chao Liang et al.
Nature communications, 10(1), 4579-4579 (2019-10-09)
Rheumatoid arthritis (RA) is a chronic inflammatory disorder characterized by progressive bone erosion. Leflunomide is originally developed to suppress inflammation via its metabolite A77 1726 to attenuate bone erosion. However, distinctive responsiveness to Leflunomide is observed among RA individuals. Here
S C Chang et al.
Cell death and differentiation, 21(9), 1388-1398 (2014-05-03)
The checkpoint between the life and death of macrophages is crucial for the host's frontline immune defense during acute phase infection. However, the mechanism as to how the immune cell equilibrates between apoptosis and immune response is unclear. Using in

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico