Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos

EHU094671

Sigma-Aldrich

MISSION® esiRNA

targeting human TDP1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAATGCCATGCCACATATTAAGACATATATGAGGCCTTCTCCAGACTTCAGTAAAATTGCTTGGTTCCTTGTCACAAGCGCAAATCTGTCCAAGGCTGCCTGGGGAGCATTGGAGAAGAATGGCACCCAGCTGATGATCCGCTCCTACGAGCTCGGGGTCCTTTTCCTCCCTTCAGCATTTGGTCTAGACAGTTTCAAAGTGAAACAGAAGTTCTTCGCTGGCAGCCAGGAGCCAATGGCCACCTTTCCTGTGCCATATGATTTGCCTCCAGAACTGTATGGAAGTAAAGATCGGCCATGGATATGGAACATTCCTTATGTCAAAGCACCGGATACGCATGGGAACATGTGGGTGCCCTCCTGAGAATCTTGAGGCACTGTGAAATTTAAGTGTAAGACATTGAGCCACAAACATGGAATC

Ensembl | human accession no.

ENSG00000042088

NCBI accession no.

NM_018319

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... TDP1(55775) , TDP1(55775)

Categorías relacionadas

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Benu Brata Das et al.
Nucleic acids research, 42(7), 4435-4449 (2014-02-05)
Poly(ADP-ribose) polymerases (PARP) attach poly(ADP-ribose) (PAR) chains to various proteins including themselves and chromatin. Topoisomerase I (Top1) regulates DNA supercoiling and is the target of camptothecin and indenoisoquinoline anticancer drugs, as it forms Top1 cleavage complexes (Top1cc) that are trapped
Alejandro Álvarez-Quilón et al.
Molecular cell, 78(6), 1152-1165 (2020-06-10)
The APEX2 gene encodes APE2, a nuclease related to APE1, the apurinic/apyrimidinic endonuclease acting in base excision repair. Loss of APE2 is lethal in cells with mutated BRCA1 or BRCA2, making APE2 a prime target for homologous recombination-defective cancers. However
Sourav Saha et al.
Cell reports, 33(13), 108569-108569 (2020-12-31)
The present study demonstrates that topoisomerase 3B (TOP3B) forms both RNA and DNA cleavage complexes (TOP3Bccs) in vivo and reveals a pathway for repairing TOP3Bccs. For inducing and detecting cellular TOP3Bccs, we engineer a "self-trapping" mutant of TOP3B (R338W-TOP3B). Transfection with
Curtis W Bacon et al.
Molecular cell, 78(6), 1133-1151 (2020-05-14)
Precise control of the RNA polymerase II (RNA Pol II) cycle, including pausing and pause release, maintains transcriptional homeostasis and organismal functions. Despite previous work to understand individual transcription steps, we reveal a mechanism that integrates RNA Pol II cycle

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico