Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU094381

Sigma-Aldrich

MISSION® esiRNA

targeting human SKP2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTCCACGGCATACTGTCTCAGTGTTCCAAGTTGCAGAATCTAAGCCTGGAAGGCCTGCGGCTTTCGGATCCCATTGTCAATACTCTCGCAAAAAACTCAAATTTAGTGCGACTTAACCTTTCTGGGTGTTCTGGATTCTCTGAATTTGCCCTGCAGACTTTGCTAAGCAGCTGTTCCAGACTGGATGAGCTGAACCTCTCCTGGTGTTTTGATTTCACTGAAAAGCATGTACAGGTGGCTGTTGCGCATGTGTCAGAGACCATCACCCAGCTGAATCTTAGCGGCTACAGAAAGAATCTCCAGAAATCAGATCTCTCTACTTTAGTTAGAAGATGCCCCAATCTTGTCCATCTAGACTTAAGTGATAGTGTCATGCTAAAGAATGACTGCTTTCAGGAATTTTTCCAGCTCAACTACCTCCA

Ensembl | nº de acceso humano

ENSG00000145604

Nº de acceso NCBI

NM_005983

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... SKP2(6502) , SKP2(6502)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
ZYU
KXU
JPU
PKU
BKU

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Shirly Lahav-Baratz et al.
Reproductive biomedicine online, 32(3), 308-315 (2016-01-23)
This preliminary study examined a possible effect of long duration repeated hormonal stimulation on the endometrium using a molecular tool. The expression of the hormone stimulated, cell cycle regulators, p27 and its ligase S-phase kinase-interacting protein2 (Skp2), were assessed in
Wei Yan et al.
Cancer biotherapy & radiopharmaceuticals, 34(7), 451-458 (2019-04-27)
Background: Mantle cell lymphoma (MCL) is associated with poor patient prognosis mainly due to incomplete response to chemotherapy. S-phase
Yingduan Cheng et al.
Oncotarget, 8(2), 1972-1982 (2016-12-29)
Recent findings on the existence of oncogenic fusion genes in a wide array of solid tumors, including head and neck squamous cell carcinoma (HNSCC), suggests that fusion genes have become attractive targets for cancer diagnosis and treatment. In this study
Gatha Thacker et al.
Life sciences, 257, 118041-118041 (2020-07-06)
Transcription factor CCAAT/Enhancer binding protein alpha (C/EBPα) is a key regulator of myeloid differentiation, granulopoiesis in particular. Although CEBPA mutations are found in more than 10% in AML, functional inhibition of C/EBPα protein is also widely observed in AML. Here
Fan Yao et al.
Nature communications, 9(1), 2269-2269 (2018-06-13)
Dysregulation of YAP localization and activity is associated with pathological conditions such as cancer. Although activation of the Hippo phosphorylation cascade is known to cause cytoplasmic retention and inactivation of YAP, emerging evidence suggests that YAP can be regulated in
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico