Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU091281

Sigma-Aldrich

MISSION® esiRNA

targeting human FNDC3B

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCAAGTAACCAGAATGCACCTATAAATTATGGAGCATTGTAGATTTTACCACATCAATTCATAGCAGTAACTTTAAGAGGGCATTGTGCAATAGTTAGTTGTTTTCTTGTTCAGCTATTTTAAAGGCTGCTTTAACTTGTTTGTTTGTCTTTGTATATAACTACTTCTAATCTAATCACTAGAGTTATTATATTCTGTTATGTTTGACCAGAATTATATGACAAGAACTGGTGACAGTTTAGTGCCTCTGCCCATTGTCCATGATTTACACTAATTGTGAGCAGTCTTCTTATGTGTCAGCTCATTATTTTTGAAACATTTGCCTTTAGGCTGTTCTTTGAGGTATCAATGAAGTGATTGAATTTCAATACCTTAATTCAGTGCACATAATACTAATGTAACAGCAGATGAAAATTGATAAAACCC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Tingting Bian et al.
Experimental and therapeutic medicine, 17(5), 3317-3326 (2019-04-17)
Fibronectin (FN) type III domain containing 3B (FNDC3B), a member of the FN family, regulates the invasion and metastasis of cells in numerous tumor types. However, the mechanisms through which FNDC3B regulates carcinogenesis in lung adenocarcinoma (LADC) tissues have remained
Kimberly E Maxfield et al.
Molecular and cellular biology, 36(24), 3048-3057 (2016-10-05)
Triple-negative breast cancer (TNBC) is a highly heterogeneous disease with multiple, distinct molecular subtypes that exhibit unique transcriptional programs and clinical progression trajectories. Despite knowledge of the molecular heterogeneity of the disease, most patients are limited to generic, indiscriminate treatment

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico