Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos

EHU089731

Sigma-Aldrich

MISSION® esiRNA

targeting human SMAD5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGACCAGGAAGTCCATTTCAGCTCCCAGCTGATACGCCTCCTCCTGCCTATATGCCACCTGATGATCAGATGGGTCAAGATAATTCCCAGCCTATGGATACAAGCAATAATATGATTCCTCAGATTATGCCCAGTATATCCAGCAGGGATGTTCAGCCTGTTGCCTATGAAGAGCCTAAACATTGGTGTTCAATAGTCTACTATGAATTAAACAATCGTGTTGGAGAAGCTTTTCATGCATCTTCTACTAGTGTGTTAGTAGATGGATTCACAGATCCTTCAAATAACAAAAGTAGATTCTGCTTGGGTTTGTTGTCAAATGTTAATCGTAATTCGACAATTGAAAACACTAGGCGACATATTGGAAAAGGTGTTCATCTGTACTATGTTGGTGGAGAGGTGTATGCGGAATGCCTCAGTGACAGCAG

Ensembl | human accession no.

ENSG00000113658

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SMAD5(4090) , SMAD5(4090)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Mateusz Opyrchal et al.
Oncotarget, 8(53), 91803-91816 (2017-12-07)
Although the majority of breast cancers initially respond to the cytotoxic effects of chemotherapeutic agents, most breast cancer patients experience tumor relapse and ultimately die because of drug resistance. Breast cancer cells undergoing epithelial to mesenchymal transition (EMT) acquire a
Moyuan Deng et al.
Cell and tissue research, 361(3), 723-731 (2015-04-07)
Local application of bone morphogenetic protein 2 (BMP2) is known to promote large bone defect healing and BMP2-initiated bone regeneration could be enhanced by an additional mechanical stimulation. The C-terminal 24-a.a. peptide of mechano growth factor (MGF24E), a mechanical-sensitive molecule
Linda T Doan et al.
PloS one, 7(9), e44009-e44009 (2012-09-18)
Insights into Bone morphogenetic protein (Bmp) functions during forebrain development have been limited by a lack of Bmp signaling readouts. Here we used a novel Bmp signaling reporter ("BRE-gal" mice) to study Bmp signaling in the dorsal telencephalon. At early
Mingyue Nie et al.
Biology of reproduction, 93(4), 98-98 (2015-09-25)
In mammals, follicular atresia can be partially triggered by granulosa cell apoptosis. However, very little is known about the functions of miRNAs in granulosa cell apoptosis. We previously reported that hsa-mir-23a (miR-23a) and hsa-mir-27a (miR-27a) were highly expressed in the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico