Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos

EHU088381

Sigma-Aldrich

MISSION® esiRNA

targeting human EGLN1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCTGGCGCTCGAGTACATCGTGCCGTGCATGAACAAGCACGGCATCTGTGTGGTGGACGACTTCCTCGGCAAGGAGACCGGACAGCAGATCGGCGACGAGGTGCGCGCCCTGCACGACACCGGGAAGTTCACGGACGGGCAGCTGGTCAGCCAGAAGAGTGACTCGTCCAAGGACATCCGAGGCGATAAGATCACCTGGATCGAGGGCAAGGAGCCCGGCTGCGAAACCATTGGGCTGCTCATGAGCAGCATGGACGACCTGATACGCCACTGTAACGGGAAGCTGGGCAGCTACAAAATCAATGGCCGGACGAAAGCCATGGTTGCTTGTTATCCGGGCAATGGAACGGGTTATGTACGTCATGTTGATAATCCAAATGGAGATGGAAGATGTGTGAC

Ensembl | human accession no.

ENSG00000135766

NCBI accession no.

NM_022051

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... EGLN1(54583) , EGLN1(54583)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Junqiang Guo et al.
Artificial cells, nanomedicine, and biotechnology, 48(1), 37-45 (2019-12-20)
Background: Prolyl hydroxylase domain proteins (PHD2) is an oxygen sensor that is able to induce hypoxia-inducible factor-α (HIF-α) degradation under normoxic condition. The present paper designed to reveal the function of PHD2 in hepatocellular carcinoma (HCC) cells proliferation, migration and
Junping Hu et al.
Scientific reports, 7(1), 15878-15878 (2017-11-22)
Proteinuria is closely associated with the progression of chronic kidney diseases (CKD) by producing renal tubulointerstitial fibrosis. Over-activation of hypoxia inducible factor (HIF)-1α has been implicated in the progression of CKD. The present study tested the hypothesis that HIF-1α mediates
Hyo Jeong Yong et al.
Oncotarget, 8(41), 69833-69846 (2017-10-21)
Hypoxia-induced interleukin-32β (IL-32β) shifts the metabolic program to the enhanced glycolytic pathway. In the present study, the underlying mechanism by which hypoxia-induced IL-32β stability is regulated was investigated in ovarian cancer cells. IL-32β expression increased under hypoxic conditions in ovarian
Anindya Dey et al.
Science advances, 6(27) (2020-09-17)
The stringent expression of the hypoxia inducible factor-1α (HIF-1α) is critical to a variety of pathophysiological conditions. We reveal that, in normoxia, enzymatic action of cystathionine β-synthase (CBS) produces H2S, which persulfidates prolyl hydroxylase 2 (PHD2) at residues Cys21 and
Kai Zhu et al.
International journal of nanomedicine, 9, 5203-5215 (2014-11-28)
Mesenchymal stem cell (MSC) transplantation has attracted much attention in myocardial infarction therapy. One of the limitations is the poor survival of grafted cells in the ischemic microenvironment. Small interfering RNA-mediated prolyl hydroxylase domain protein 2 (PHD2) silencing in MSCs

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico