Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU088291

Sigma-Aldrich

MISSION® esiRNA

targeting human RASSF1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTGCAAACAGAACAGGGTCATGTTTGCAGGGGTGACGGCCCTCATCTATGAGGAAAGGTTTTGGATCTTGAATGTGGTCTCAGGATATCCTTATCAGAGCTAAGGGTGGGTGCTCAGAATAAGGCAGGCATTGAGGAAGAGTCTTGGTTTCTCTCTACAGTGCCAACTCCTCACACACCCTGAGGTCAGGGAGTGCTGGCTCACAGTACAGCATGTGCCTTAATGCTTCATATGAGGAGGATGTCCCTGGGCCAGGGTCTGTGTGAATGTGGGCACTGGCCCAGGTTCATACCTTATTTGCTAATCAAAGCCAGGGTCTCTCCCTCAGGTGTTTTTTATGAAGTGCGTGAATGTATGTAATGTGTGGTGGCCTCAGCTGAATGCCTCCTGTGGGGAAAGGGGTTGGGGTGACAGTCATCATCAGGGCCTG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Junhui Yu et al.
Oncology reports, 40(4), 1959-1970 (2018-08-15)
MicroRNA (miR)‑181a is a member of the miR‑181 family that serves a key role in the pathogenesis of various cancer types. The present study aimed to investigate the interaction between miR‑181a and Ras association domain family protein1 isoform A (RASSF1A)
Swati Dabral et al.
Nature communications, 10(1), 2130-2130 (2019-05-16)
Hypoxia signaling plays a major role in non-malignant and malignant hyperproliferative diseases. Pulmonary hypertension (PH), a hypoxia-driven vascular disease, is characterized by a glycolytic switch similar to the Warburg effect in cancer. Ras association domain family 1A (RASSF1A) is a

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico