Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU086561

Sigma-Aldrich

MISSION® esiRNA

targeting human MBNL1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTGCCGAACATCTGACTAGCCACAAGTATGTTACCCAGATGTAGAATTTTCATCACTAAACAATCATGCTAAAGAGGAAAGGACAGTGTGCTTGGTTAGAGTAAAGGACGAGGTCATTAGCCATATTGTATATATCGTCAAGCAACACACACAAAAGTTCCTCAGCCACAAGACATCCACATATTGCATGTTAACCAGAAGAAAAGACAACATTTTCCGGAAATCCACTGCACACTGTTGCCTATACACTTTGTACATTTAATTGATATTTGTGCTGAGGTGATATTCCTGTCTAAAAGAACAACATTGTCTTTCTTTTCTAGCACAGAGTTATGCATTCAAAGATGCATACCTAGTTAGTTTCCTATATATTCATGCCATCTTGAAAAGACAGACTATGG

Ensembl | nº de acceso humano

ENSG00000152601

Nº de acceso NCBI

NM_207297

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... MBNL1(4154) , MBNL1(4154)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
FDU
FYS
QHS
FQR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Svetlana S Itskovich et al.
Nature communications, 11(1), 2369-2369 (2020-05-14)
Despite growing awareness of the biologic features underlying MLL-rearranged leukemia, targeted therapies for this leukemia have remained elusive and clinical outcomes remain dismal. MBNL1, a protein involved in alternative splicing, is consistently overexpressed in MLL-rearranged leukemias. We found that MBNL1
Łukasz J Sznajder et al.
Nature communications, 11(1), 2022-2022 (2020-04-26)
The thymus is a primary lymphoid organ that plays an essential role in T lymphocyte maturation and selection during development of one arm of the mammalian adaptive immune response. Although transcriptional mechanisms have been well documented in thymocyte development, co-/post-transcriptional
Sandra Fischer et al.
RNA (New York, N.Y.), 26(5), 648-663 (2020-03-05)
Hypoxia is a hallmark of solid cancers, supporting proliferation, angiogenesis, and escape from apoptosis. There is still limited understanding of how cancer cells adapt to hypoxic conditions and survive. We analyzed transcriptome changes of human lung and breast cancer cells
Hongfei Liu et al.
Nucleic acids research, 46(12), 6069-6086 (2018-05-18)
We report the detailed transcriptomic profiles of human innate myeloid cells using RNA sequencing. Monocytes migrate from blood into infected or wounded tissue to differentiate into macrophages, and control inflammation via phagocytosis or cytokine secretion. We differentiated culture primary monocytes
Tanner Stokes et al.
Cell reports, 32(5), 107980-107980 (2020-08-07)
Loading of skeletal muscle changes the tissue phenotype reflecting altered metabolic and functional demands. In humans, heterogeneous adaptation to loading complicates the identification of the underpinning molecular regulators. A within-person differential loading and analysis strategy reduces heterogeneity for changes in
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico