Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EHU085201

Sigma-Aldrich

MISSION® esiRNA

targeting human NDRG1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGTCGAGGCTAGAGGCATTTGGAACAACAAATCTACGTAGTTAACTTGAAGAAACCGATTTTTAAAGTTGGTGCATCTAGAAAGCTTTGAATGCAGAAGCAAACAAGCTTGATTTTTCTAGCATCCTCTTAATGTGCAGCAAAAGCAGGCGACAAAATCTCCTGGCTTTACAGACAAAAATATTTCAGCAAACGTTGGGCATCATGGTTTTTGAAGGCTTTAGTTCTGCTTTCTGCCTCTCCTCCACAGCCCCAACCTCCCACCCCTGATACATGAGCCAGTGATTATTCTTGTTCAGGGAGAAGATCATTTAGATTTGTTTTGCATTCCTTAGAATGGAGGGCAACATTCCACAGCTGCCCTGGCTGTGATGAGTGTCCTTGCAGGGGCCGGAGTAGGAGCACTGGGGTGGGGGTGGAATTGGGGTTACTCGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jinju Liu et al.
Human cell, 33(4), 1176-1185 (2020-08-07)
Numerous studies demonstrated that microRNAs (miRNAs) were highly involved in pancreatic cancer development. However, the functional roles of many miRNAs remain elusive in pancreatic cancer. In the present study, we analyzed previous published microarray data and found that miR-1469-5p was
Gang Cen et al.
Oncology reports, 37(2), 1189-1195 (2017-01-12)
The N-myc downstream regulated gene 1 (NDRG1) is differently expressed in human malignancies according to the tumor type. We investigated the expression of NDRG1 in pancreatic cancer tissues and cell lines as well as how it affects tumor growth, invasion and
Aiwei Li et al.
Scientific reports, 9(1), 5166-5166 (2019-03-28)
N-myc downstream regulated gene 1 (NDRG1) is an intracellular protein involved in cell differentiation and was recently reported to exert various effects in several cancers. However, its expression and role in bladder cancer remain unclear. Our study enrolled 100 bladder
Nan Meng et al.
Molecular reproduction and development, 86(9), 1210-1223 (2019-07-25)
Embryo implantation is an essential step for a successful pregnancy, and any defect in this process can lead to a range of pregnancy pathologies. The objective of this study was to explore the role of N-myc downregulated gene 1 (NDRG1)
Zhi-Yan Hu et al.
Biochimica et biophysica acta, 1852(9), 1876-1886 (2015-06-15)
N-myc downstream-regulated gene 1 (NDRG1) has been implicated in tumorigenesis and metastasis in different cancers. However, its role in nasopharyngeal carcinoma remains unknown. We found that NDRG1 expression level was high in nasopharyngeal cancer 5-8F cells but low in 5-8F-LN

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico