Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU082891

Sigma-Aldrich

MISSION® esiRNA

targeting human GFPT1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGCCTGTGATGGTGGAACTAGCAAGTGACTTCCTGGACAGAAACACACCAGTCTTTCGAGATGATGTTTGCTTTTTCCTTAGTCAATCAGGTGAGACAGCAGATACTTTGATGGGTCTTCGTTACTGTAAGGAGAGAGGAGCTTTAACTGTGGGGATCACAAACACAGTTGGCAGTTCCATATCACGGGAGACAGATTGTGGAGTTCATATTAATGCTGGTCCTGAGATTGGTGTGGCCAGTACAAAGGCTTATACCAGCCAGTTTGTATCCCTTGTGATGTTTGCCCTTATGATGTGTGATGATCGGATCTCCATGCAAGAAAGACGCAAAGAGATCATGCTTGGATTGAAACGGCTGCCTGATTTGATTAAGGAAGTACTGAGCATGGATGACGAAATTCA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Nana Zhang et al.
Cell death & disease, 10(5), 343-343 (2019-04-26)
Cigarette smoking has been shown to be a carcinogenic factor in breast cancer. Nicotine (Nic), an active component of tobacco, has been found to induce epithelial-mesenchymal transition (EMT) in breast cancer cells. However, the alterations in protein O-GlcNAcylation in Nic-mediated
Yubo Liu et al.
Cell death & disease, 9(5), 485-485 (2018-05-01)
Chemoresistance has become a major obstacle to the success of cancer therapy, but the mechanisms underlying chemoresistance are not yet fully understood. O-GlcNAcylation is a post-translational modification that is regulated by the hexosamine biosynthetic pathway (HBP) and has an important

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico