Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU080821

Sigma-Aldrich

MISSION® esiRNA

targeting human RHOT1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGCCTGGAATATTTGGGCTATCTAGGCTATTCAATATTGACTGAGCAAGAGTCTCAAGCTTCAGCTGTTACAGTGACAAGAGATAAAAAGATAGACCTGCAGAAAAAACAAACTCAAAGAAATGTGTTCAGATGTAATGTAATTGGAGTGAAAAACTGTGGGAAAAGTGGAGTTCTTCAGGCTCTTCTTGGAAGAAACTTAATGAGGCAGAAGAAAATTCGTGAAGATCATAAATCCTACTATGCGATTAACACTGTTTATGTATATGGACAAGAGAAATACTTGTTGTTGCATGATATCTCAGAATCGGAATTTCTAACTGAAGCTGAAATCATTTGTGATGTTGTATGCCTGGTATATGATGTCAGCAATCCCAAATCCTTTGAATACTGTGCCAGGATTTTTAAGCAACACTTTATGGACAGCAGAATACCTTGCT

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ekta Agarwal et al.
Molecular and cellular biology, 39(14) (2019-05-08)
The Myc gene is a universal oncogene that promotes aggressive cancer, but its role in metastasis has remained elusive. Here, we show that Myc transcriptionally controls a gene network of subcellular mitochondrial trafficking that includes the atypical mitochondrial GTPases RHOT1
Tanveer Ahmad et al.
The EMBO journal, 33(9), 994-1010 (2014-01-17)
There is emerging evidence that stem cells can rejuvenate damaged cells by mitochondrial transfer. Earlier studies show that epithelial mitochondrial dysfunction is critical in asthma pathogenesis. Here we show for the first time that Miro1, a mitochondrial Rho-GTPase, regulates intercellular

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico