Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU080731

Sigma-Aldrich

MISSION® esiRNA

targeting human RAPGEF4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGCACTAACGTGGGAGAAACTGCCAAGCAAGTTCAAGAAGTTCTATGCGGAGTTTGAAAGTTTAATGGACCCTTCAAGGAACCACAGGGCCTACAGGCTGACAGTAGCTAAGCTGGAACCTCCTCTCATCCCCTTCATGCCTTTGCTCATTAAAGATATGACATTTACTCATGAGGGGAACAAGACGTTCATTGACAATCTAGTAAACTTTGAAAAAATGCGCATGATTGCAAATACGGCCAGAACAGTGAGATACTACAGGAGCCAACCCTTCAATCCTGATGCAGCTCAAGCTAATAAGAACCATCAGGATGTCCGGAGTTATGTACGGCAATTAAATGTGATTGACAACCAGAGAACTTTATCACAGATGTCACACAGATTAGAGCCTCGTCGACCATAGA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Kazuya Kusama et al.
Reproduction, fertility, and development (2018-05-08)
Protein kinase A (PKA) signalling accompanies elevated intracellular cAMP levels during endometrial stromal cell (ESC) decidualisation. Exchange protein directly activated by cAMP (EPAC), an alternate mediator of cAMP signalling, promotes PKA analogue-induced decidualisation; however, the precise mechanism by which EPAC
Wei Sun et al.
Biochemical and biophysical research communications, 485(2), 355-359 (2017-02-22)
Cyclic adenosine 3'-5'-monophosphate (cAMP) plays a crucial role in regulating pituitary cell proliferation and hormone synthesis. Recent evidence suggests that exchange proteins directly activated by cAMP (Epacs) may mediate the effects of cAMP. Here we used rat anterior pituitary GH3
Kazuya Kusama et al.
Reproduction (Cambridge, England), 147(6), 897-906 (2014-03-04)
The optimal decidualization of endometrial stromal cells (ESCs) following embryo implantation is one of the critical steps to establish pregnancy in rodents and humans. This step is intricately regulated by ovarian hormones. Using in vitro human ESCs model, we previously

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico