Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU078741

Sigma-Aldrich

MISSION® esiRNA

targeting human GAB2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCTCCCAAACAATGACTTCCTGCCATGTTTGATGGGGACAGCTACCACTGTCCTCTGCCCCCATTCCCCTTTCAGCTCCCATGAGCATGCATAGTTCACCAGACCAATGGCCTAGCCATTCTCTAAGTCCCATCCTGGAAGAAGTTATTTCTTCAAGAGCTGCACCTCTCCTCCTAGCATTAGTTTAGATCAACTCAAGGAGTATTTATTAATGGCTGCTGTCTCCAGTTTCTGGGGTTAAGCACTAAGGACACAAGAATCAATCAGACCTTCTCCCTGAACTTAAGATAGCCACAATCAGAAAAAGGACAAGGACATGAGACAGTGGTGATGGCCATCAGACAGAGACTTCAAATGCTGATGGAGGGCAGAGGAAGTACTTAGGGAGGTTGGTGTCAGAGGCAG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Peng Zhang et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 50(1), 52-65 (2018-10-17)
HER2 has been implicated in mammary tumorigenesis as well as aggressive tumor growth and metastasis. Its overexpression is related to a poor prognosis and chemoresistance in breast cancer patients. Although Grb2-associated binding protein 2 (Gab2) is important in the development
Xiang-Rui Qiao et al.
Oncology letters, 20(4), 99-99 (2020-08-25)
The development of prostate cancer is complicated and involves a number of tumor-associated gene expression level abnormalities. Gene chip technology is a high-throughput method that can detect gene expression levels in different tissues and cells on a large scale. In
Jiuhong Ma et al.
Oncology reports, 37(2), 1159-1167 (2016-12-22)
Glioma is the most frequent and aggressive primary tumor of the brain in humans. Over the last few decades, significant progress has been made in early detection and multi-mode treatments, but the prognosis of gliomas is still extremely poor. MicroRNAs
Wen Jie Wang et al.
International journal of clinical and experimental pathology, 8(9), 10575-10584 (2015-12-01)
Non-small cell lung cancer (NSCLC) is a leading cause of cancer-related death and often has a poor prognosis. Investigation of NSCLC cancer cell migration, invasion and development of strategies to block this process is essential to improve the disease prognosis.
Yiping Huang et al.
Biochemical and biophysical research communications, 503(3), 2028-2032 (2018-08-11)
The functionality of lncRNA snaR has only been characterized in breast cancer and colon cancer. The aim of the current study is to explore the involvement of lncRNA snaR in ovarian carcinoma (OC). Expression of lncRNA snaR and GRB2-associated binding

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico