Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU077821

Sigma-Aldrich

MISSION® esiRNA

targeting human ZBTB20

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
$220.00
50 μG
$391.00

$220.00


Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).


Seleccione un Tamaño

Cambiar Vistas
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00


Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGACTTTCACCGCCAAACAGAACTACGTCAAGCACATGTTCGTACACACAGGTGAGAAGCCCCACCAATGCAGCATCTGTTGGCGCTCCTTCTCCTTAAAGGATTACCTTATCAAGCACATGGTGACACACACAGGAGTGAGGGCATACCAGTGTAGTATCTGCAACAAGCGCTTCACCCAGAAGAGCTCCCTCAACGTGCACATGCGCCTCCACCGGGGAGAGAAGTCCTACGAGTGCTACATCTGCAAAAAGAAGTTCTCTCACAAGACCCTCCTGGAGCGACACGTGGCCCTGCACAGTGCCAGCAATGGGACCCCCCCTGCAGGCACACCCCCAGGTGCCCGCGCTGGCCCCCCAGGCGTGGTGGCCTGCACGGAGGGGACCACTTACGTCTGCTCCGTCTGCCCAGCAAAGTTTGACCAAATCGAGCAGTTCAACGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

An-Jing Ren et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(10), 13862-13876 (2020-08-28)
The zinc-finger protein ZBTB20 regulates development and metabolism in multiple systems, and is essential for postnatal survival in mice. However, its potential role in the cardiovascular system remains undefined. Here, we demonstrate that ZBTB20 is critically involved in the regulation
Liuyang Wang et al.
Cell host & microbe, 24(2), 308-323 (2018-08-10)
Pathogens have been a strong driving force for natural selection. Therefore, understanding how human genetic differences impact infection-related cellular traits can mechanistically link genetic variation to disease susceptibility. Here we report the Hi-HOST Phenome Project (H2P2): a catalog of cellular
Ji Liu et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 48(5), 2074-2083 (2018-08-14)
To determine the cellular functions and clinical significance of micro-758-5p (miR-758-5p) in glioblastoma (GBM) by targeting zinc finger and BTB domain-containing protein 20 (ZBTB20). Fifty-five paired GBM tissues and adjacent normal tissues, GBM cell lines (U118, LN-299, H4, A172, U87-MG

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico