Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU076001

Sigma-Aldrich

MISSION® esiRNA

targeting human YWHAZ

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGAAGCCACAATGTTCTTGGCCCATCATGACATTGGGTAGCATTAACTGTAAGTTTTGTGCTTCCAAATCACTTTTTGGTTTTTAAGAATTTCTTGATACTCTTATAGCCTGCCTTCAATTTTGATCCTTTATTCTTTCTATTTGTCAGGTGCACAAGATTACCTTCCTGTTTTAGCCTTCTGTCTTGTCACCAACCATTCTTACTTGGTGGCCATGTACTTGGAAAAAGGCCGCATGATCTTTCTGGCTCCACTCAGTGTCTAAGGCACCCTGCTTCCTTTGCTTGCATCCCACAGACTATTTCCCTCATCCTATTTACTGCAGCAAATCTCTCCTTAGTTGATGAGACTGTGTTTATCTCCCTTTAAAACCCTACCTATCCTGAATGGTCTGTCATTGTCTGCCT

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Wenrui Wang et al.
Cell death & disease, 8(10), e3071-e3071 (2017-10-06)
MicroRNAs (miRNAs) have been identified as major post-transcriptional regulators of the initiation and progression of human cancers, including breast cancer. However, the detail role of miR-451 has not been fully elucidated in breast cancer. In this study, we aimed to
Lei Yan et al.
Environmental toxicology, 35(9), 1015-1028 (2020-05-19)
Breast cancer (BC) is the leading cause of cancer-related death in women worldwide and one of the most prevalent malignancy. In recent years, increasing evidence had illuminated that long noncoding RNAs (lncRNAs) serve as critical factors in multiple tumor progression
Jie Shi et al.
Oncology reports, 41(2), 1101-1112 (2018-12-12)
Ovarian cancer is one of the three most deadly gynecological cancers, with the highest mortality rate. As the main cause of death, metastasis is considered to be a crucial factor that reduces the survival time of ovarian carcinoma patients. YWHAZ
Langyong Mao et al.
American journal of cancer research, 5(6), 1939-1953 (2015-08-14)
The deregulation of microRNAs has been demonstrated in various tumor processes. Here, we report that microRNA-544 (miR-544) is decreased in cervical cancer tissues compared with normal cervical tissues. To identify the mechanisms involved in miR-544 deregulation, we studied the regulation
Gareth E Lim et al.
Nature communications, 6, 7671-7671 (2015-07-30)
The proteins that coordinate complex adipogenic transcriptional networks are poorly understood. 14-3-3ζ is a molecular adaptor protein that regulates insulin signalling and transcription factor networks. Here we report that 14-3-3ζ-knockout mice are strikingly lean from birth with specific reductions in

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico