Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU075631

Sigma-Aldrich

MISSION® esiRNA

targeting human AL358113.1, TJP2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCTTGGGAGTCAGATCTTCGTAAAGGAAATGACCCGAACGGGTCTGGCAACTAAAGATGGCAACCTTCACGAAGGAGACATAATTCTCAAGATCAATGGGACTGTAACTGAGAACATGTCTTTAACGGATGCTCGAAAATTGATAGAAAAGTCAAGAGGAAAACTACAGCTAGTGGTGTTGAGAGACAGCCAGCAGACCCTCATCAACATCCCGTCATTAAATGACAGTGACTCAGAAATAGAAGATATTTCAGAAATAGAGTCAAACCGATCATTTTCTCCAGAGGAGAGACGTCATCAGTATTCTGATTATGATTATCATTCCTCAAGTGAGAAGCTGAAGGAAAGGCCAAGTTCCAGAGAGGACACGCCGAGCAGATTGTCCAGGATGGGTGCGACACCCACTCCCTTTAAGTCCACAGGGGATATTGCAGGCACAGTTGTCC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Alexander X Cartagena-Rivera et al.
Nature communications, 8(1), 1030-1030 (2017-10-19)
Maintenance of epithelial tissue integrity requires coordination between cell-cell adherens junctions, tight junctions (TJ), and the perijunctional actomyosin cytoskeleton. Here we addressed the hypothesis that alterations in TJ structure and remodeling of the actomyosin cytoskeleton modify epithelial mechanics. Current methods
Arturo Raya-Sandino et al.
Biochimica et biophysica acta. Molecular cell research, 1864(10), 1714-1733 (2017-05-31)
Silencing Zonula occludens 2 (ZO-2), a tight junctions (TJ) scaffold protein, in epithelial cells (MDCK ZO-2 KD) triggers: 1) Decreased cell to substratum attachment, accompanied by reduced expression of claudin-7 and integrin β1, and increased vinculin recruitment to focal adhesions

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico