Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU075421

Sigma-Aldrich

MISSION® esiRNA

targeting human BCL6

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAAGGCATTGGTGAAGACAAAATGGCCTCGCCGGCTGACAGCTGTATCCAGTTCACCCGCCATGCCAGTGATGTTCTTCTCAACCTTAATCGTCTCCGGAGTCGAGACATCTTGACTGATGTTGTCATTGTTGTGAGCCGTGAGCAGTTTAGAGCCCATAAAACGGTCCTCATGGCCTGCAGTGGCCTGTTCTATAGCATCTTTACAGACCAGTTGAAATGCAACCTTAGTGTGATCAATCTAGATCCTGAGATCAACCCTGAGGGATTCTGCATCCTCCTGGACTTCATGTACACATCTCGGCTCAATTTGCGGGAGGGCAACATCATGGCTGTGATGGCCACGGCTATGTACCTGCAGATGGAGCATGTTGTGGACACTTGCCGGAAGTTTATTAAGGCCAGTGAAGCAGAGATGGTTTCTGCCATCAAGCCTCCTCGTGAAGA

Ensembl | human accession no.

ENSG00000113916

NCBI accession no.

NM_001706

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... BCL6(604) , BCL6(604)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Britta Jasmer et al.
Oncotarget, 8(65), 108643-108654 (2018-01-10)
The oncogene B-cell lymphoma 6 (BCL6) is associated with lymphomagenesis. Intriguingly, its expression is increased in preeclamptic placentas. Preeclampsia is one of the leading causes of maternal and perinatal mortality and morbidity. Preeclamptic placentas are characterized by various defects like
Marie-Sophie Fabre et al.
PloS one, 15(4), e0231470-e0231470 (2020-04-23)
The prognosis for people with the high-grade brain tumor glioblastoma is very poor, due largely to low cell death in response to genotoxic therapy. The transcription factor BCL6, a protein that normally suppresses the DNA damage response during immune cell
Min Gao et al.
Aging, 12(10), 9275-9291 (2020-05-16)
Nucleus accumbens-associated protein 1 (NAC1) has multifaceted roles in cancer pathogenesis and progression, including the development of drug resistance, promotion of cytokinesis, and maintenance of "stem cell-like" phenotypes. NAC1 is a transcriptional co-regulator belonging to the bric-a-brac tramtrack broad (BTB)
Andreas Ritter et al.
International journal of molecular sciences, 21(21) (2020-11-14)
Human placentation is a highly invasive process. Deficiency in the invasiveness of trophoblasts is associated with a spectrum of gestational diseases, such as preeclampsia (PE). The oncogene B-cell lymphoma 6 (BCL6) is involved in the migration and invasion of various
Siraj M El Jamal et al.
Laboratory investigation; a journal of technical methods and pathology, 99(4), 539-550 (2018-11-18)
Myocyte enhancer-binding factor 2B (MEF2B) has been implicated as a transcriptional regulator for BCL6. However, details about the interaction between MEF2B and BCL6 during expression, as well as the relationship of MEF2B to the expression of other germinal center (GC)
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico