Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU070441

Sigma-Aldrich

MISSION® esiRNA

targeting human NFIB

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCAAAGATATTCGCCAGGAGTATCGAGAGGACTTTGTGCTCACCGTGACTGGCAAGAAGCACCCGTGCTGTGTCTTATCCAATCCCGACCAGAAGGGTAAGATTAGGAGAATCGACTGCCTGCGACAGGCAGACAAAGTCTGGCGTCTGGATCTAGTCATGGTGATCCTGTTCAAAGGCATCCCCTTGGAAAGTACCGATGGAGAGCGGCTCATGAAATCCCCACATTGCACAAACCCAGCACTTTGTGTCCAGCCACATCATATCACAGTATCAGTTAAGGAGCTTGATTTGTTTTTGGCATACTACGTGCAGGAGCAAGATTCTGGACAATCAGGAAGTCCAAGCCACAATGATCCTGCCAAGAATCCTCCAGGTTACCTTGAGGATAGTTTTGTAAAATCTGGAGTCTTCAATGTATCAGAACTTGTAAGAGTATCCAGAACGCCCATAACC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Q-Y Liu et al.
European review for medical and pharmacological sciences, 24(13), 7266-7275 (2020-07-25)
Long non-coding RNAs (lncRNAs) have been found to exert specific functions in the progression of ovarian cancer (OC), except for lncRNA-OIP5-AS1. In this study, we aim at exploring the molecular mechanisms of OIP5-AS1 in OC. The expression levels of OIP5-AS1
Jing Chen et al.
Viruses, 7(10), 5539-5552 (2015-10-30)
Porcine reproductive and respiratory syndrome virus (PRRSV) infection strongly modulates the host's immune response. The RNA silencing pathway is an intracellular innate response to viral infections. However, it is unknown whether PRRSV interacts with cellular RNA silencing to facilitate the
Anna Yu-Szu Huang et al.
Neuron, 106(6), 992-1008 (2020-04-23)
Astrocytes play essential roles in brain function by supporting synaptic connectivity and associated circuits. How these roles are regulated by transcription factors is unknown. Moreover, there is emerging evidence that astrocytes exhibit regional heterogeneity, and the mechanisms controlling this diversity

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico