Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU069131

Sigma-Aldrich

MISSION® esiRNA

targeting human XBP1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCAGCCCCTCAGAGAATGATCACCCTGAATTCATTGTCTCAGTGAAGGAAGAACCTGTAGAAGATGACCTCGTTCCGGAGCTGGGTATCTCAAATCTGCTTTCATCCAGCCACTGCCCAAAGCCATCTTCCTGCCTACTGGATGCTTACAGTGACTGTGGATACGGGGGTTCCCTTTCCCCATTCAGTGACATGTCCTCTCTGCTTGGTGTAAACCATTCTTGGGAGGACACTTTTGCCAATGAACTCTTTCCCCAGCTGATTAGTGTCTAAGGAATGATCCAATACTGTTGCCCTTTTCCTTGACTATTACACTGCCTGGAGGATAGCAGAGAAGCCTGTCTGTACTTCATTCAAAAAGCCAAAATAGAGAGTATACAGTCCTAGAGAATTCCTCTATTTGTTCAGATCTCATAGATGACCCCCAGGTATTGTCTTTTGACATCCAGCAGTCCAAGGT

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yukako Tokutake et al.
International journal of molecular sciences, 21(1) (2020-01-01)
In skeletal muscle, myoblast differentiation results in the formation of multinucleated myofibers. Although recent studies have shown that unfolded protein responses (UPRs) play an important role in intracellular remodeling and contribute to skeletal muscle differentiation, the involvement of IRE1-XBP1 signaling
A-F Song et al.
European review for medical and pharmacological sciences, 24(22), 11675-11682 (2020-12-05)
Rheumatoid arthritis (RA) is an autoimmune, inflammatory disease mainly manifested by joint damage. Its mechanism is not completely clear at present. Previous studies have found that microRNA-34a-5p (miR-34a-5p) is involved in the development of many inflammatory diseases. In this study
Joshua M Royal et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(12), 13527-13545 (2019-09-29)
Cholera toxin B subunit (CTB) exhibits broad-spectrum biologic activity upon mucosal administration. Here, we found that a recombinant CTB containing an endoplasmic reticulum (ER) retention motif (CTB-KDEL) induces colon epithelial wound healing in colitis via the activation of an unfolded
Hui-Ting Hsu et al.
Clinica chimica acta; international journal of clinical chemistry, 479, 66-71 (2018-01-07)
Squamous cell carcinoma is the most common cancer of the oral cavity. In spite of advancements in surgical, chemoradiological and targeted therapies, these therapeutic strategies still have had little impact on survival rates. X-box binding protein-1 (XBP-1) is a potent
Akihiro Kishino et al.
Scientific reports, 7(1), 4442-4442 (2017-07-02)
The purpose of this study was to clarify the relationship among X-box-binding protein 1 unspliced, spliced (XBP1u, s), Forkhead box O1 (FoxO1) and autophagy in the auditory cells under endoplasmic reticulum (ER) stress. In addition, the relationship between ER stress

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico