Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU065891

Sigma-Aldrich

MISSION® esiRNA

targeting human MKI67

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTCCAACAAGCACAAAGCAATGGCCTAAGAGAAGTCTCAGGAAAGCAGATGTAGAGGAAGAATTCTTAGCACTCAGGAAACTAACACCATCAGCAGGGAAAGCCATGCTTACGCCCAAACCAGCAGGAGGTGATGAGAAAGACATTAAAGCATTTATGGGAACTCCAGTGCAGAAACTGGACCTGGCAGGAACTTTACCTGGCAGCAAAAGACAGCTACAGACTCCTAAGGAAAAGGCCCAGGCTCTAGAAGACCTGGCTGGCTTTAAAGAGCTCTTCCAGACTCCTGGTCACACCGAGGAATTAGTGGCTGCTGGTAAAACCACTAAAATACCCTGCGACTCTCCACAGTCAGACCCAGTGGACACCCCAACAAGCACAAAGCAACGACCCAAGAGAAGTATCAGGAAAGCAGATGTAGAGGGAGAACTCTTAGCGTGCAGGAATCTAATGCCATCAGCAGGC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yusuke Horiuchi et al.
Gastric cancer : official journal of the International Gastric Cancer Association and the Japanese Gastric Cancer Association, 19(1), 160-165 (2014-12-11)
The differences in the growth morphology, proliferative ability, and background mucosa of the cancer between Helicobacter pylori (HP)-positive (HP+) gastric cancer (GC) and HP-negative (HP-) GC are still unclear. To clarify the differences, we compared the characteristics of the two
Richard A Byrd et al.
Endocrinology, 156(7), 2417-2428 (2015-04-11)
The tumorigenic potential of dulaglutide was evaluated in rats and transgenic mice. Rats were injected sc twice weekly for 93 weeks with dulaglutide 0, 0.05, 0.5, 1.5, or 5 mg/kg corresponding to 0, 0.5, 7, 20, and 58 times, respectively
Jianhui Ma et al.
Cancer cell, 35(3), 504-518 (2019-03-05)
Ionizing radiation (IR) and chemotherapy are standard-of-care treatments for glioblastoma (GBM) patients and both result in DNA damage, however, the clinical efficacy is limited due to therapeutic resistance. We identified a mechanism of such resistance mediated by phosphorylation of PTEN
Quim Castellví et al.
Bioelectrochemistry (Amsterdam, Netherlands), 105, 16-24 (2015-05-09)
Delivery of the so-called Tumor Treatment Fields (TTFields) has been proposed as a cancer therapy. These are low magnitude alternating electric fields at frequencies from 100 to 300 kHz which are applied continuously in a non-invasive manner. Electric field delivery
Jian-Hong Fang et al.
Hepatology (Baltimore, Md.), 62(2), 452-465 (2015-02-26)
Early metastasis is responsible for frequent relapse and high mortality of hepatocellular carcinoma (HCC), but its underlying mechanisms remain unclear. Epithelial-mesenchymal transition (EMT) has been considered a key event in metastasis. Based on histological examination of serial HCC sections and

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico