Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU065641

Sigma-Aldrich

MISSION® esiRNA

targeting human CCDC6

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGCAGCAAGAGAACAAGGTGCTGAAGATAGAGCTGGAGACCTACAAACTGAAGTGCAAGGCACTGCAGGAGGAGAACCGCGACCTGCGCAAAGCCAGCGTGACCATCCAAGCCAGGGCTGAGCAGGAAGAAGAATTCATTAGTAACACTTTATTCAAGAAAATTCAGGCTTTGCAGAAGGAGAAAGAAACCCTTGCTGTAAATTATGAGAAAGAAGAAGAATTCCTCACTAATGAGCTCTCCAGAAAATTGATGCAGTTGCAGCATGAGAAAGCCGAACTAGAACAGCATCTTGAACAAGAGCAGGAATTTCAGGTCAACAAACTGATGAAGAAAATTAAAAAACTGGAGAATGACACCATTTCTAAGCAACTTACATTAGAACAGTTGAGACGGGAGAAGATTGACCTTGAAAATACATTGGAACAAGAACAAGAAGCACTAGTTAATCGCCTCTGGAAAAGGAT

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Francesco Morra et al.
Lung cancer (Amsterdam, Netherlands), 135, 56-65 (2019-08-27)
CCDC6 (coiled-coil domain containing 6) is a player of the HR response to DNA damage and has been predicted to interact with BAP1, another HR-DNA repair gene highly mutated in Malignant Pleural Mesothelioma (MPM), an aggressive cancer with poor prognosis.
Francesco Morra et al.
Oncotarget, 8(19), 31815-31829 (2017-04-19)
Reduced levels of the tumor suppressor protein CCDC6 sensitize cancer cells to the treatment with PARP-inhibitors. The turnover of CCDC6 protein is regulated by the de-ubiquitinase USP7, which also controls the androgen receptor (AR) stability. Here, we correlated the expression
Francesco Morra et al.
Oncotarget, 6(14), 12697-12709 (2015-04-18)
CCDC6 gene product is a pro-apoptotic protein substrate of ATM, whose loss or inactivation enhances tumour progression. In primary tumours, the impaired function of CCDC6 protein has been ascribed to CCDC6 rearrangements and to somatic mutations in several neoplasia. Recently

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico