Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU063521

Sigma-Aldrich

MISSION® esiRNA

targeting human UBE2D2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AATGGCAGCATTTGTCTTGATATTCTACGATCACAGTGGTCTCCAGCACTAACTATTTCAAAAGTACTCTTGTCCATCTGTTCTCTGTTGTGTGATCCCAATCCAGATGATCCTTTAGTGCCTGAGATTGCTCGGATCTACAAAACAGATAGAGAAAAGTACAACAGAATAGCTCGGGAATGGACTCAGAAGTATGCGATGTAATTAAAGAAATTATTGGATAACCTCTACAAATAAAGATAGGGGAACTCTGAAAGAGAAAGTCCTTTTGATTTCCATTTGACTGCTTTCTATGAGCCCACGCCTCATCTTCCCCTGTGCACATGTTTACCTGATACAGCAGTGCTGCGTGTTGTACATACTTGGAACAACAAACTAGAAATACTGTACTTCTGTACCAACATTGCCTCCTAGCA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Aitor Garzia et al.
Nature communications, 8, 16056-16056 (2017-07-08)
Cryptic polyadenylation within coding sequences (CDS) triggers ribosome-associated quality control (RQC), followed by degradation of the aberrant mRNA and polypeptide, ribosome disassembly and recycling. Although ribosomal subunit dissociation and nascent peptide degradation are well-understood, the molecular sensors of aberrant mRNAs
Qingshui Wang et al.
Biomolecules, 9(4) (2019-04-20)
Death Associated Protein Kinase 1 (DAPK1) is an important signaling kinase mediating the biological effect of multiple natural biomolecules such as IFN-γ, TNF-α, curcumin, etc. DAPK1 is degraded through both ubiquitin-proteasomal and lysosomal degradation pathways. To investigate the crosstalk between

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico