Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU061351

Sigma-Aldrich

MISSION® esiRNA

targeting human NEDD4L

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTCTGCCACGGACAACTACACCCTTCAGATCAACCCTAATTCAGGCCTCTGTAATGAGGATCATTTGTCCTACTTCACTTTTATTGGAAGAGTTGCTGGTCTGGCCGTATTTCATGGGAAGCTCTTAGATGGTTTCTTCATTAGACCATTTTACAAGATGATGTTGGGAAAGCAGATAACCCTGAATGACATGGAATCTGTGGATAGTGAATATTACAACTCTTTGAAATGGATCCTGGAGAATGACCCTACTGAGCTGGACCTCATGTTCTGCATAGACGAAGAAAACTTTGGACAGACATATCAAGTGGATTTGAAGCCCAATGGGTCAGAAATAATGGTCACAAATGAAAACAAAAGGGAATATATCGACTTAGTCATCCAGTGGAGATTTGTGAACAGGGTCCAGAAGCAGATG

Ensembl | nº de acceso humano

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Kimberly Gomez et al.
Molecular brain, 14(1), 20-20 (2021-01-23)
Voltage-gated sodium channels are key players in neuronal excitability and pain signaling. Functional expression of the voltage-gated sodium channel NaV1.7 is under the control of SUMOylated collapsin response mediator protein 2 (CRMP2). When not SUMOylated, CRMP2 forms a complex with
Jonathan R Hughes et al.
Frontiers in cell and developmental biology, 8, 607060-607060 (2020-12-08)
8-Oxoguanine DNA glycosylase (OGG1) is the major cellular enzyme required for the excision of 8-oxoguanine DNA base lesions in DNA through the base excision repair (BER) pathway, and therefore plays a major role in suppressing mutagenesis and in controlling genome
Yuan Wang et al.
Biochemical and biophysical research communications, 531(4), 581-587 (2020-08-20)
The ubiquitin-proteasome system (UPS) is composed of E1 ubiquitin-activating enzyme, E2 ubiquitin-conjugating enzyme, and E3 ubiquitin ligase, which play a fundamental role in mediating intracellular protein degradation. Ferroptosis is a non-apoptotic regulated cell death caused by iron accumulation and subsequent
Neil J Grimsey et al.
Cell reports, 24(12), 3312-3323 (2018-09-21)
Ubiquitination is essential for protein degradation and signaling and pivotal to many physiological processes. Ubiquitination of a subset of G-protein-coupled receptors (GPCRs) by the E3 ligase NEDD4-2 is required for p38 activation, but how GPCRs activate NEDD4-2 to promote ubiquitin-mediated
Dong-Eun Lee et al.
Cell death & disease, 11(1), 38-38 (2020-01-22)
In mammals, autophagosome formation is initiated by ULK1 via the posttranslational modification of this protein. However, the precise role of ULK1 ubiquitination in modulating autophagy is unknown. Here, we show that NEDD4L, an E3 ubiquitin ligase, binds ULK1 in pancreatic

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico