Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU060981

Sigma-Aldrich

MISSION® esiRNA

targeting human WAPL

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CAGAAGAGGCCCAATTTCAAACCAGATATCCAAGAAATTCCGAAGAAACCTAAAGTGGAAGAAGAAAGTACTGGAGATCCTTTTGGATTTGATAGTGATGATGAGTCTCTACCAGTTTCTTCAAAGAATTTAGCCCAGGTTAAGTGTTCCTCTTATTCAGAATCTAGTGAAGCTGCTCAGTTGGAAGAGGTCACTTCAGTACTTGAAGCTAATAGCAAAATTAGTCATGTGGTCGTTGAAGACACTGTCGTTTCTGATAAATGCTTCCCTTTGGAGGACACTTTACTTGGGAAAGAAAAGAGCACAAACCGAATTGTAGAAGATGATGCAAGCATAAGTAGCTGTAATAAATTAATAACTTCAGATAAAGTGGAGAATTTTCATGAAGAACATGAAAAGAATAGTCACCATATTCACAAAAATGCTGATGACAGTACTAAGAAACCCAATGCAGAAACTACAGTGGCTTCTGAAATCAAGGA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Alexandra M Pinzaru et al.
Genes & development, 34(23-24), 1619-1636 (2020-10-31)
Mutations in the telomere-binding protein POT1 are associated with solid tumors and leukemias. POT1 alterations cause rapid telomere elongation, ATR kinase activation, telomere fragility, and accelerated tumor development. Here, we define the impact of mutant POT1 alleles through complementary genetic
Sheroy Minocherhomji et al.
Nature, 528(7581), 286-290 (2015-12-04)
Oncogene-induced DNA replication stress has been implicated as a driver of tumorigenesis. Many chromosomal rearrangements characteristic of human cancers originate from specific regions of the genome called common fragile sites (CFSs). CFSs are difficult-to-replicate loci that manifest as gaps or

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico