Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU060921

Sigma-Aldrich

MISSION® esiRNA

targeting human FAF1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
$220.00
50 μG
$391.00

$220.00


Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).


Seleccione un Tamaño

Cambiar Vistas
20 μG
$220.00
50 μG
$391.00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

$220.00


Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACCAACGTGTTCTGCTCACAAATGCTTTGTGCTGAATCCATTGTTTCTTATCTGAGTCAAAATTTTATAACCTGGGCTTGGGATCTGACAAAGGACTCCAACAGAGCAAGATTTCTCACTATGTGCAATAGACACTTTGGCAGTGTTGTGGCACAAACCATTCGGACTCAAAAAACGGATCAGTTTCCGCTTTTCCTGATTATTATGGGAAAGCGATCATCTAATGAAGTGTTGAATGTGATACAAGGGAACACAACAGTAGATGAGTTAATGATGAGACTCATGGCTGCAATGGAGATCTTCACAGCCCAACAACAGGAAGATATAAAGGACGAGGATGAACGTGAAGCCAGAGAAAATGTGAAGAGAGAGCAAGATGAGGCCTATCGCCTTTCACTTGAGGCTGACAGAGCAAAGA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Soonhwa Song et al.
Molecular and cellular biology, 36(7), 1136-1151 (2016-01-27)
This study is designed to examine the cellular functions of human Fas-associated factor 1 (FAF1) containing multiple ubiquitin-related domains. Microarray analyses revealed that interferon-stimulated genes related to the antiviral response are significantly increased in FAF1-knockdown HeLa cells. Silencing FAF1 enhanced
NLRP2 and FAF1 deficiency blocks early embryogenesis in the mouse.
Hui Peng et al.
Reproduction (Cambridge, England), 154(3), 145-151 (2017-06-21)
Pauline G Knox et al.
The Journal of cell biology, 192(3), 391-399 (2011-02-02)
CD40, a tumor necrosis factor (TNF) receptor family member, is widely recognized for its prominent role in the antitumor immune response. The immunostimulatory effects of CD40 ligation on malignant cells can be switched to apoptosis upon disruption of survival signals

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico