Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU059261

Sigma-Aldrich

MISSION® esiRNA

targeting human TFEB

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCGGCAGAAGAAAGACAATCACAACTTAATTGAAAGGAGACGAAGGTTCAACATCAATGACCGCATCAAGGAGTTGGGAATGCTGATCCCCAAGGCCAATGACCTGGACGTGCGCTGGAACAAGGGCACCATCCTCAAGGCCTCTGTGGATTACATCCGGAGGATGCAGAAGGACCTGCAAAAGTCCAGGGAGCTGGAGAACCACTCTCGCCGCCTGGAGATGACCAACAAGCAGCTCTGGCTCCGTATCCAGGAGCTGGAGATGCAGGCTCGAGTGCACGGCCTCCCTACCACCTCCCCGTCCGGCATGAACATGGCTGAGCTGGCCCAGCAGGTGGTGAAGCAGGAGCTGCCTAGCGAAGAGGGCCCAGGGGAGGCCCTGATGCTGGGGGCTGAGGTCCCTGACCCTGAGCCACTGCCAGCTCTGCCCCCGCAAGCCCCGCTGCCCCTGCCCACCCAGCCACCATCCCCATTCCATCACCTGGACTTCAGCCAC

Ensembl | nº de acceso humano

ENSG00000112561

Nº de acceso NCBI

NM_007162

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... TFEB(7942) , TFEB(7942)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
DCV
PAV
PZU
FVU
MOU

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Sijie Tan et al.
Scientific reports, 9(1), 727-727 (2019-01-27)
Mitochondrial dysfunction underscores aging and diseases. Mitophagy (mitochondria + autophagy) is a quality control pathway that preserves mitochondrial health by targeting damaged mitochondria for autophagic degradation. Hence, molecules or compounds that can augment mitophagy are therapeutic candidates to mitigate mitochondrial-related diseases. However
Xingchen Zhao et al.
The Journal of pathology, 245(2), 235-248 (2018-03-24)
Insufficient autophagy in podocytes is related to podocyte injury in diabetic nephropathy (DN). Advanced glycation end-products (AGEs) are major factors of podocyte injury in DN. However, the role and mechanism of AGEs in autophagic dysfunction remain unknown. We investigated autophagic
Muzo Wu et al.
American journal of physiology. Lung cellular and molecular physiology, 313(1), L138-L153 (2017-04-15)
Downregulation of the alveolar macrophage (AM) receptor with collagenous structure (MARCO) leads to susceptibility to postinfluenza bacterial pneumonia, a major cause of morbidity and mortality. We sought to determine whether immunomodulation of MARCO could improve host defense and resistance to
Li He et al.
Journal of leukocyte biology, 100(5), 1113-1124 (2016-11-02)
Macrophage dysfunction in obesity and diabetes is associated with persistent inflammation and poor wound healing responses. Relevant to these phenotypes, we have previously shown that macrophage activation in a high-fat environment results in cell death via a mechanism that involves
Raquel Parra-Millán et al.
mSphere, 3(2) (2018-03-31)
Acinetobacter baumannii is a significant human pathogen associated with hospital-acquired infections. While adhesion, an initial and important step in A. baumannii infection, is well characterized, the intracellular trafficking of this pathogen inside host cells remains poorly studied. Here, we demonstrate that
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico