Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU058861

Sigma-Aldrich

MISSION® esiRNA

targeting human RIPK3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGACTGACCCCTGCACAGACAGACCCCTTCCCCTCTCTGCGAAAGGACCAAGCCCCAGAAGTCACTCCATCTCCTACGGCTCGCAATTTCCAGAGGCCCCCTGGCACCTTCCAGCCTGATGTCGTGCGTCAAGTTATGGCCCAGCGGTGCCCCCGCCCCCTTGGTGTCCATCGAGGAACTGGAGAACCAGGAGCTCGTCGGCAAAGGCGGGTTCGGCACAGTGTTCCGGGCGCAACATAGGAAGTGGGGCTACGATGTGGCGGTCAAGATCGTAAACTCGAAGGCGATATCCAGGGAGGTCAAGGCCATGGCAAGTCTGGATAACGAATTCGTGCTGCGCCTAGAAGGGGTTATCGAGAAGGTGAACTGGGACCAAGATCCCAAGCCGGCTCTGGTGACTAAATTCATGGAGAACGGCTC

Ensembl | nº de acceso humano

ENSG00000129465

Nº de acceso NCBI

NM_006871

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... RIPK3(11035) , RIPK3(11035)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
LVU
JUU
QCS
DZT
KXT

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Alessandra Pescatore et al.
Cell death & disease, 7(8), e2346-e2346 (2016-08-26)
Incontinentia Pigmenti (IP) is a rare X-linked disease characterized by early male lethality and multiple abnormalities in heterozygous females. IP is caused by NF-κB essential modulator (NEMO) mutations. The current mechanistic model suggests that NEMO functions as a crucial component
Diego Martin-Sanchez et al.
Scientific reports, 7, 41510-41510 (2017-02-01)
Iron deficiency has been associated with kidney injury. Deferasirox is an oral iron chelator used to treat blood transfusion-related iron overload. Nephrotoxicity is the most serious and common adverse effect of deferasirox and may present as an acute or chronic
Yu Matsuzawa-Ishimoto et al.
The Journal of experimental medicine, 214(12), 3687-3705 (2017-11-02)
A variant of the autophagy gene
R S Al-Lamki et al.
Cell death & disease, 7(6), e2287-e2287 (2016-07-01)
We previously reported that renal clear cell carcinoma cells (RCC) express both tumor necrosis factor receptor (TNFR)-1 and -2, but that, in organ culture, a TNF mutein that only engages TNFR1, but not TNFR2, causes extensive cell death. Some RCC
Xinghui Li et al.
Immunity, 50(3), 576-590 (2019-02-17)
Elevated glucose metabolism in immune cells represents a hallmark feature of many inflammatory diseases, such as sepsis. However, the role of individual glucose metabolic pathways during immune cell activation and inflammation remains incompletely understood. Here, we demonstrate a previously unrecognized
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico