Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EHU058161

Sigma-Aldrich

MISSION® esiRNA

targeting human CYP1A1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGATAAGCACGTTGCAGGAGCTGATGGCAGGGCCTGGGCACTTTAACCCCTACAGGTATGTGGTGGTATCAGTGACCAATGTCATCTGTGCCATTTGCTTTGGCCGGCGCTATGACCACAACCACCAAGAACTGCTTAGCCTAGTCAACCTGAATAATAATTTCGGGGAGGTGGTTGGCTCTGGAAACCCAGCTGACTTCATCCCTATTCTTCGCTACCTACCCAACCCTTCCCTGAATGCCTTCAAGGACCTGAATGAGAAGTTCTACAGCTTCATGCAGAAGATGGTCAAGGAGCACTACAAAACCTTTGAGAAGGGCCACATCCGGGACATCACAGACAGCCTGATTGAGCACTGTCAGGAGAAGCAGCTGGATGAGAACGCCAATGTCCAGCTGTCAGATGAGAAGATCATTAACATCGTCTTGGACCTCTTTGGAGCTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hanna Piotrowska-Kempisty et al.
Toxicology letters, 267, 59-66 (2017-01-04)
The role of CYP1A1 and CYP1B1 enzymes in the biotransformation and biological activity of the methylated resveratrol analogue, 3,4,5,4'-tetramethoxystilbene (DMU-212) is still elusive. Our recently published data have shown that one of the metabolites of DMU-212, 3'-hydroxy-3,4,5,4'-tetramethoxystilbene (DMU-214) exerts more
Marta Vuerich et al.
Journal of hepatology, 74(1), 48-57 (2020-07-15)
In autoimmune hepatitis (AIH), the imbalance between regulatory T cells (Tregs) and T-helper type 17 (Th17) cells has been linked to low levels of CD39, an ectoenzyme that hydrolyses ATP, ultimately generating immunosuppressive adenosine. Upregulation of CD39 results from activation
Laura MacPherson et al.
International journal of molecular sciences, 15(5), 7939-7957 (2014-05-09)
The aryl hydrocarbon receptor (AHR) regulates the toxic effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). The AHR repressor (AHRR) is an AHR target gene and functions as a ligand-induced repressor of AHR; however, its mechanism of inhibition is controversial. Recently, we reported that

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico