Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU055991

Sigma-Aldrich

MISSION® esiRNA

targeting human UBIAD1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACTTGTGGACCGAATCTTGGAGCCGCAGGATGTCGTCCGGTTCGGAGTCTTCCTCTACACGTTGGGCTGCGTCTGTGCCGCTTGCCTCTACTACCTGTCCCCTCTGAAACTGGAGCACTTGGCTCTTATCTACTTTGGAGGCCTGTCTGGCTCCTTTCTCTACACAGGAGGAATTGGATTCAAGTACGTGGCTCTGGGAGACCTCATCATCCTCATCACTTTTGGCCCGCTGGCTGTGATGTTCGCCTACGCCATCCAGGTGGGGTCCCTGGCCATCTTCCCACTGGTCTATGCCATCCCCCTCGCCCTCAGCACCGAGGCCATTCTCCATTCCAACAACACCAGGGACATGGAGTCCGACCGGGAGGCTGGTATCGTCACGCTGGCCATCCTCATCGGCCCCACGTTCTCCTACATTCTCTACAACACACTGCTCTTCCTGCCCTA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Liang Yan et al.
American journal of translational research, 12(10), 6277-6289 (2020-11-17)
Exosome-encapsulated microRNAs (miRNAs) have been identified as potential cancer biomarkers and pro-tumorigenic mediators for several cancers. However, the miRNA profiling in BCa-Exo (exosomes from plasma of patients with bladder cancer) has not yet been explored. Hence, the aim of this
Bingju Yan et al.
Molecular medicine reports, 16(5), 6910-6915 (2017-09-14)
UbiA prenyltransferase domain containing 1 (UBIAD1) is closely associated with cardiovascular diseases. However, at the cellular level, little is known about how UBIAD1 is expressed and functions in cardiomyocyte hypertrophy. The aim of the present study was to investigate the expression

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico