Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU055031

Sigma-Aldrich

MISSION® esiRNA

targeting human TYR

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TACGGCGTAATCCTGGAAACCATGACAAATCCAGAACCCCAAGGCTCCCCTCTTCAGCTGATGTAGAATTTTGCCTGAGTTTGACCCAATATGAATCTGGTTCCATGGATAAAGCTGCCAATTTCAGCTTTAGAAATACACTGGAAGGATTTGCTAGTCCACTTACTGGGATAGCGGATGCCTCTCAAAGCAGCATGCACAATGCCTTGCACATCTATATGAATGGAACAATGTCCCAGGTACAGGGATCTGCCAACGATCCTATCTTCCTTCTTCACCATGCATTTGTTGACAGTATTTTTGAGCAGTGGCTCCGAAGGCACCGTCCTCTTCAAGAAGTTTATCCAGAAGCCAATGCACCCATTGGACATAACCGGGAATCCTACATGGTTCCTTTTATACCACTGTACAGAAATGGTGATTTCTTTATTTCATCCAAAGATCTGGGC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Shinya Kasamatsu et al.
Journal of dermatological science, 76(1), 16-24 (2014-08-02)
Tyrosinase, the rate-limiting enzyme required for melanin production, has been targeted to develop active brightening/lightening materials for skin products. Unexpected depigmentation of the skin characterized with the diverse symptoms was reported in some subjects who used a tyrosinase-competitive inhibiting quasi-drug
Yuichi Sekine et al.
The Journal of biological chemistry, 290(28), 17462-17473 (2015-05-30)
Melanoma is the most serious type of skin cancer, with a highly metastatic phenotype. In this report, we show that signal transducing adaptor protein 2 (STAP-2) is involved in cell migration, proliferation, and melanogenesis as well as chemokine receptor expression

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico