Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU054421

Sigma-Aldrich

MISSION® esiRNA

targeting human NACC1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCCCGGCTGAACTTATCAACCAGATTGGGAACCGCTGCCACCCCAAGCTCTACGACGAGGGCGACCCCTCTGAGAAGCTGGAGCTGGTGACAGGCACCAACGTGTACATCACAAGGGCGCAGCTGATGAACTGCCACGTCAGCGCAGGCACGCGGCACAAGGTCCTACTGCGGCGGCTCCTGGCCTCCTTCTTTGACCGGAACACGCTGGCCAACAGCTGCGGCACCGGCATCCGCTCTTCTACCAACGATCCCCGTCGGAAGCCCCTGGACAGCCGCGTGCTCCACGCTGTCAAGTACTACTGCCAGAACTTCGCCCCCAACTTCAAGGAGAGCGAGATGAATGCCATCGCGGCCGACATGTGCACCAACGCCCGCCGCGTCGTGCGCAAGAGCTGGATGCCCAAGGTCAAGGTGCTCAAGGCTGAGGATGACGCCTACACCACCTTC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hong-Fang Tao et al.
Oncology reports, 45(2), 469-480 (2021-01-09)
Long non‑coding RNA (lncRNA) forkhead box P4 antisense RNA 1 (FOXP4‑AS1) has been determined to function as an oncogene in various types of cancer. However, the biological function and the underlying mechanisms of FOXP4‑AS1 in mantle cell lymphoma (MCL) remain to be uncovered. The
Kohei Morita et al.
Cancers, 10(10) (2018-09-27)
The nucleus accumbens-associated protein 1 (NACC1) is a transcription factor constitutively expressed in the urothelium, where it regulates cell growth, senescence, autophagy, and epithelial-mesenchymal transition. microRNA (miRNA) constitutes a class of small non-coding RNAs which are involved in cell proliferation
Xiao-Han Tang et al.
Cancer medicine, 8(14), 6426-6436 (2019-09-07)
Heparin-binding epidermal growth factor-like growth factor (HB-EGF) is a new promising target for the treatment of ovarian cancer. Our previous study showed that cross-reacting material 197 (CRM197), a specific HB-EGF inhibitor, significantly reverses resistance against paclitaxel in paclitaxel-resistant ovarian cancer

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico